High-Salt Augments Aldosterone Toxicity Despite Lowered Plasma-Readings

[Tristan Loscha]

Front Immunol. 2019; 10: 828.
Published online 2019 Apr 18. doi: 10.3389/fimmu.2019.00828
PMCID: PMC6482216
PMID: 31057551
The Impact of Hyperosmolality on Activation and Differentiation of B Lymphoid Cells
Ljiljana Cvetkovic,1,2 Stojan Perisic,2,3 Jens Titze,2,4 Hans-Martin Jäck,1 and Wolfgang Schuh1,*
Author information Article notes Copyright and License information Disclaimer
This article has been cited by other articles in PMC.
Associated Data
Supplementary Materials
Go to:
Abstract
B lymphocytes, as a central part of adaptive immune responses, have the ability to fight against an almost unlimited numbers of pathogens. Impairment of B cell development, activation and differentiation to antibody secreting plasma cells can lead to malignancy, allergy, autoimmunity and immunodeficiency. However, the impact of environmental factors, such as hyperosmolality or osmotic stress caused by varying salt concentrations in different lymphoid organs, on these processes is not well-understood. Here, we report that B cells respond to osmotic stress in a biphasic manner. Initially, increased osmolality boosted B cell activation and differentiation as shown by an untimely downregulation of Pax5 as well as upregulation of CD138. However, in the second phase, we observed an increase in cell death and impaired plasmablast differentiation. Osmotic stress resulted in impaired class switch to IgG1, inhibition of phosphorylation of p38 mitogen-activated kinase and a delayed NFAT5 response. Overall, these findings demonstrate the importance of microenvironmental hyperosmolality and osmotic stress caused by NaCl for B cell activation and differentiation.

Keywords: NaCl, hypertonicity, hyperosmolality, B cells, plasmablasts, plasma cells
Go to:
Introduction
B cell development in bone marrow of mice and men is a highly regulated, multi-step process which results in generation of B-cell-receptor-expressing immature B cells. Immature B cells leave bone marrow via blood stream and home to secondary lymphoid organs, in which they differentiate into naive, mature B cells. Lymph and blood perfuse secondary lymphoid organs, such as spleen, lymph nodes, tonsils, Peyer's patches and other gut-associated lymphoid tissues (GALT) and enable thereby the circulation of mature B cells through the body (1–3). Formation of germinal centers requires B cell migration, within secondary lymphatic organs (4, 5). It has been reported that skin (6), inflamed tissues (7, 8) and lymphoid organs (9) are the sites of increased osmolality compared to blood. Therefore, when trafficking through the body and changing, thereby, their microenvironment, immune cells are facing osmotic stress.

Macrophages, for instance, are attracted to the skin interstitium where they regulate Na+ release from the skin Na+ reservoir through lymph vessels driven by a NFAT5/VEGF-C signaling pathway (10). NFAT5 is the transcription factor responsible for hypertonicity-induced transcription of osmoadaptive genes, such as aldose reductase, neuropathy target esterase, betaine transporter, sodium/myo-inositol cotransporter, and sodium/chloride-dependent taurine transporter (11). Moreover, high salt diet can induce a pathogenic Th17 phenotype in mice (12) and thereby contributes to the development of EAE, a murine model of multiple sclerosis (13). Hybridoma cells increase antibody production when cultured under hyperosmotic conditions (14–16). Partial loss of NFAT5 function in NFAT5 heterozygous mice impairs B cell proliferation and reduces antigen specific responses to protein antigen (9). In addition, it has been reported that guanine nucleotide exchange factor Brx induces expression of NFAT5 through the activity of p38/MAPK in response to osmotic stress which enables B cells to differentiate and produce antibodies (17).

How increased osmolality affects B cell activation is poorly understood. Therefore, we wanted to investigate how osmotic stress influences B cell growth and viability and whether increased osmolality influences terminal B cell differentiation and antibody production. Therefore, we established an in vitro system for B cell cultivation under increased osmolality. To induce osmotic stress we used cell culture media with an increased NaCl concentration (+40 mM) in order to mimic an elevation in NaCl concentration similar to that found in the skin of rodents fed on a prolonged high salt diet (10) or in the infected skin of mice bitten by their cage mates (7), compared to the concentrations found in blood.

Here, we demonstrate that changes in osmolality affect B cell activation. LPS-stimulated B cells respond to increased osmolality in a biphasic manner. In the first phase, increased osmolality enhances differentiation into antibody-producing plasma cells; in the second phase, the initial boost disappears and we observed an arrest of proliferation and increased cell death. In contrast to other immune cells (T cells and macrophages), p38/MAPK pathway in B cells is inhibited by an increase in osmolality, moreover, an upregulation of NFAT5 does not seem to be regulated by this pathway. This in vitro model provides an excellent starting point to understand the molecular circuits that control B cell homeostasis under hyperosmotic conditions.

Go to:
Materials and Methods
Mice
C57BL/6NRj mice were purchased from Janvier Labs (Le Genest Saint Isle, France). Blimp1-GFP mice were kindly provided by Steven Nutt (WEHI Institute, Australia). All animals were kept under pathogen-free conditions in the animal facility of the Franz-Penzoldt Center or Nikolaus-Fiebiger Center (Erlangen, Germany). All animal experiments were performed according to institutional and national guidelines.

B Cell Isolation and Cell Culture
Naive B cells from the spleen were isolated by negative selection using the EasySep™ Mouse B cell Isolation Kit from StemCell Technologies (Vancouver, Canada). Previously obtained single cell suspensions were treated according to manufacturer's instructions. Briefly, cells were incubated with normal rat serum and EasySep™ Mouse B cell Isolation Cocktail at room temperature for 2.5 min. Later on, cells were labeled with the EasySep™ Streptavidin RapidSpheres™ for 2.5 min at room temperature. Using the EasySep™ Magnet, B cells were separated. Cell numbers were calculated and isolation purity was checked by flow cytometry. Cells were cultured in complete RPMI medium [containing 10% FCS, 1 mM sodium pyruvate, 50 U/ml penicillin, 50 μg/ml streptomycin, and 50 μM β-mercapto-ethanol (Gibco by Thermo Fisher Scientific, Waltham, MA, USA)] or complete RPMI medium supplemented with 40 mM NaCl to achieve hyperosmotic environment and activated with 10 μg/ml lipopolysaccharides (LPS; Sigma Aldrich, St. Louis, MO, USA). To induce class switch to IgG1 100 U/ml IL4 (Miltenyi Biosciences, Bergisch-Gladbach, Germany) was combined with 10 μg/ml LPS. Starting cell density was 0.25 × 106 cells/ml.

Antibodies and Flow Cytometric Analyses
For surface staining, 106 isolated cells were stained with the respective antibodies for 20 min on ice. Unspecific bindings were blocked using CD16/CD32-unlabeled antibodies for 15 min on ice before each staining. For PAX5 intracellular staining, cells were fixed, permeabilized using the Foxp3 transcription factor staining kit (eBioScience, San Diego, CA, USA), and then stained as described. For measurements of phosphorylated p38 (p-p38) cells were fixed with 1.5% PFA and permeabilized with methanol and stained for 30 min at room temperature with anti-p-p38 (eBioscience, clone: ANIT4KK). AnnexinV was purchased from eBioscience, and staining was performed according to the manufacturer's protocol. Propidium iodide (PI) was added prior analysis. Fluorochrome-conjugated goat anti-mouse IgM (μHC specific) was obtained from Southern Biotechnology (Birmingham, AL, USA), and fluorochrome-conjugated monoclonal antibodies against CD19 (clone: 6D5), TACI (clone: ebio8F10-3), CD138 (clone: 281-2), CD62L (clone: MEL-14), CD69 (clone: H1.2F3), CD83 (clone: Michel-19), CD86 (clone: GL-1), PAX5 (clone: 1H9), IgG1 (clone: X56) were obtained from eBioscience, BD Biosciences, or BioLegend (San Diego, CA, USA). For analyses of surface markers and Blimp1:GFP expression we excluded doublets and gated on living cells according to FSC/SSC characteristics (for gating strategy see Supplementary Figure 1). For AnnexinV/PI staining no living cell gate was applied. Flow-cytometric data were collected on a Gallios flow cytometer (Beckman Coulter) and raw data was analyzed using either FlowJo (Ashland, OR, USA) or Kaluza (Beckman Coulter, Krefeld, Germany) software.

CFSE Labeling
Intracellular and cell-surface proteins of B lymphocytes were CFSE-labeled (Sigma Aldrich, St. Louis, MO, USA) for cell division-tracking experiments. Cell suspensions of 20 × 106 cells/ml in pre-warmed PBS were incubated with 5 μM CFSE for 15 min at 37°C. To stop labeling, equal volume of cold PBS was added. For efflux, cells were incubated in PBS at 37°C for 20 min. Cells were washed 3 times with PBS. Labeled cells were cultured in 0.25 × 106 cells/ml density. Analysis of fluorescence signals was carried out using a Gallios flow cytometer (Beckman Coulter, Krefeld, Germany) and data was analyzed with FlowJo software (Ashland, OR, USA).

RNA Isolation and q-Real Time PCR
LPS-blasts from 48 to 72 h cultures were homogenized using QIAShredder columns (Qiagen, Hilden, Germany). Total RNA was isolated from the homogenized lysate with the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. RNA was reverse transcribed into cDNA using the Revert Aid First Strand cDNA synthesis kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer's instructions. qRT-PCR was performed using the SYBR™ Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) with gene-specific primers for NFAT5 (for: CAGCCAAAAGGGAACTGGAG, rev: GAAAGCCTTGCTGTGTTCTG). HPRT was used to control for integrity and abundance of the input RNA (for: TCAGTCAACGGGGGACATAAA, rev: GGGGCTGTACTGCTTAACCAG). Each template was measured in 2 technical replicates. Water and RNA control was used to determine if any contamination is present. Relative expression of the target genes was calculated according to the ΔΔCT method.

Statistical Analysis
Significances and p-values were determined with IBM SPSS software (Armonk, NY, USA) using the Mann–Whitney U test. Significance is shown as *p < 0.05, **p < 0.01, and ***p < 0.001.

Go to:
Results
To induce osmotic stress in cell culture NaCl was used. 40 mM increase of NaCl concentration in the cell culture medium corresponds to the increased local concentration found in the skin of rodents fed on a prolonged high-salt diet (10) or in the infected skin of mice bitten by cage mates (7), relative to the concentrations maintained in blood. In the following part, standard cell culture conditions will be referred to as “normal salt”, whereas cell culture condition with NaCl added will be referred to as “high salt”.

To investigate whether an increase in osmolality has an impact on growth and viability of LPS-activated mouse B cells, splenic B cells from C57BL/6 WT mice were sorted by negative magnetic cell separation and cultured in the presence or absence of high salt conditions (adding 40 mM additional NaCl) over a period of 72 h. After 48 h, no difference in cell growth was observed between normal and high salt cultures (Figure 1A). However, on 72 h, cells cultured under high salt conditions were expanded only 2-fold, whereas cells under normal salt conditions were expanded 4-fold. Flow cytometric analysis of cell viability using propidium iodide (PI) in combination with Annexin V revealed that additional 40 mM NaCl significantly decreased the viability of the cells at all analyzed time points (Figure 1B).

Figure 1
Effect of increased NaCl concentrations on growth, viability and proliferation of LPS-activated splenic B cells. Freshly isolated splenic B cells were cultured in normal medium (Normal Salt) and medium supplemented with an additional 40 mM NaCl (High Salt). Cells were activated with 10 μg/ml lipopolysaccharide (LPS). (A) Cell growth is presented by fold increase of cell numbers, which were calculated as the fold change between the starting cell density and cell density after indicated time points. The results show the summary of two independent experiments with a total of nine independent B cell isolates (N = 2, n = 9). (B) Viability of the cell culture was determined with AnnexinV/PI staining by flow cytometry. Frequencies of AnnexinV/PI positive cells are shown on representative plots for indicated time points. The summary of two independent experiments with a total of nine independent B cell isolates is presented as bar diagrams (N = 2, n = 9). (C) B cells were labeled with 5 μM CFSE and cultured for 24, 48, and 72 h in medium without and with the addition of 40 mM NaCl. Loss of CFSE fluorescence was analyzed by flow cytometry. The results are a summary of one experiment with a total of five independent B cell isolates (N = 1, n = 5). Data are presented as the mean ± SEM. **p ≤ 0.01; ***p ≤ 0.001, Mann-Whitney test.

Next, we investigated whether an increase in NaCl concentration affects the proliferation of LPS-activated B cells. Therefore, we labeled B cells with the division tracker dye CFSE and cultured them for 24, 48, and 72 h in vitro in presence or absence of additional 40 mM NaCl. Loss of CFSE fluorescence and the number of cell divisions were analyzed after 48 and 72 h. Compared to normal salt controls, B cells in high salt cultures showed an accumulation in cell division phases 0 and 1 at 48 h and in phases 2, 3, and 4 at 72 h, respectively. Moreover, high salt-treated B cells do not reach the maximum number of cell divisions achieved by B cells in normal cell cultures indicating that proliferation is impaired or delayed by high salt (Figure 1C). These findings clearly demonstrate that a hypertonic environment has a negative impact on B cell proliferation and cell viability.

To assess whether an increase in osmolality in the cell culture medium affects B cell differentiation into antibody-secreting plasmablasts, freshly MACS-sorted splenic B cells were cultured with or without the addition of NaCl. 48 and 72 h later, cultures were analyzed for the presence of B cell identity markers PAX5 and CD19 (Figure 2A). PAX5 is a transcription factor known to be a master regulator of genes required to keep B cell identity (18, 19). PAX5 blocks plasma cell differentiation and must, therefore, be downregulated during the differentiation into plasma cells (PC) (20). According to the fluorescence intensities of PAX5 and CD19, two populations were distinguishable: PAX5high/CD19high B cells and PAX5low/CD19low plasmablasts (Figure 2A). Forty-eight hours upon LPS stimulation, the PAX5high/PAX5low ratio (average 9) was significantly shifted in favor of PAX5low cells in high salt cultures compared to the ratio found in normal salt cultures (average 19). This indicates that LPS-activated B cells differentiate faster into PAX5low plasmablasts (Figure 2A). Interestingly, in 72 h LPS cultures, the ratios of PAX5high/PAX5low observed on 48 h were reversed, i.e., the high salt culture contained fewer differentiated cells compared to the normal salt culture. The change in relative PAX5 abundance between 48 and 72 h suggests that salt initially boosts the B cell response and that plasma cell differentiation is strongly enhanced.

Figure 2
Effect of increased NaCl concentrations on B cell differentiation into plasmablasts. Freshly isolated splenic B cells were cultured with 10 μg/ml LPS with (High Salt) or without (Normal Salt) additional 40 mM NaCl. (A) Intracellular abundance of PAX5 was analyzed by flow cytometry. Results were presented as ratio of frequencies of PAX5high and PAX5low cells at indicated time points. Summary of one experiment with a total of five independent B cell isolates is presented as bar diagrams (N = 1, n = 5). (B) At indicated time points, the surface abundance of TACI and CD138 was analyzed by flow cytometry, and frequencies of TACI/CD138 positive cells were calculated. The results are a summary of three independent experiments with a total of thirteen independent B cell isolates (N = 3, n = 13). (C) Cells from Blimp-1:GFP reporter mouse were surface-stained with an antibody against CD138 and analyzed by flow cytometry at indicated time points. Two different populations according to their CD138 expression and GFP fluorescence are indicated as: Blimp-1:GFP+ (Blimp-1:GFP single positive cells and Blimp-1:GFP/CD138 positive cells) and CD138+ Blimp-1:GFP− (CD138 single positive cells). Frequencies of cells are shown in representative dot plots. The results are a summary of three independent experiments with a total of eight independent B cell isolates (N = 3, n = 8). Data are presented as the mean ± SEM. *p ≤ 0.05; **p ≤ 0.01; Mann-Whitney test.

In addition, we analyzed the effect of high salt on the induction and abundance of common B cell activation markers such as CD62L, CD69, CD83, and CD86 at 6, 12, 24, 48, and 72 h after activation with LPS (Supplementary Figure 2A). We found a significant lower abundance of surface CD86 on B cells cultured under high salt conditions within the first 24 h after stimulation compared to normal salt cultures. However, at later time points no difference was observed. For CD62L, CD69, and CD83 only minor differences between normal and high salt cultures could be observed (Supplementary Figure 2A).

Next, differentiation of LPS-activated B cells in presence or absence of additional NaCl to TACI+/CD138+ plasmablasts was examined by flow cytometry (Figure 2B). TACI (transmembrane activator and CAML interactor and one of the BAFF receptors) and CD138 (syndecan-1, transmembrane heparin sulfate proteoglycan) were used as plasmablast markers (21). The frequencies of TACI+/CD138+ plasmablasts were significantly higher in 24, 48, and 72 h high salt cultures compared to cultures without additional NaCl (Figure 2B and Supplementary Figure 2B). These results indicate that B cells activated in a hypertonic environment differentiate faster to TACI+/CD138+ plasmablasts compared to an environment with lower salt concentration.

To further investigate the differentiation and activation of B cells challenged by increased NaCl concentration in the cell culture medium, intracellular abundance of Blimp-1, the master regulator of terminal B cell differentiation of activated B cells to the PCs and CD138 was analyzed (Figure 2C). For that purpose, B cells derived from the spleens of Blimp-1:GFP reporter mice was used (22). Cells activated in vitro display a notable heterogeneity in the expression of Blimp-1 and CD138, therefore, we distinguished two populations based on their expression of Blimp-1:GFP and CD138. Blimp-1:GFP+ cells: represent antibody secreting cells (22) and CD138+/Blimp-1:GFP− presumably pre-plasmablasts. The most striking difference was a significant increase in the frequencies of CD138+/Blimp-1:GFP− cells in high salt cultures after 48 and 72 h (Figure 2C). Frequencies of Blimp-1:GFP+ cells were, however, significantly reduced in high salt cultures after 72 h. In summary, these findings support again the hypothesis that a hyperosmolar environment fosters differentiation of activated B cells into antibody-secreting plasma cells. However, if plasma cells are retained in a high salt environment, they will die faster. Therefore, prolonged high salt environment acts as a potent negative regulator of plasma cell differentiation.

Upon primary antigen activation, naive B cells usually increase the production of the secreted form of IgM, which results in a decrease in the abundance of surface IgM. To determine whether hyperosmolality caused by NaCl changes the abundance of membrane-bound IgM on LPS-activated blasts, surface expression of IgM was analyzed in normal and high salt culture medium 48 and 72 h after LPS activation by flow cytometry (Figure 3A). After 48 h in culture, IgM surface abundance was the same under both culture conditions. However, after 72 h in culture there was a marked decrease in surface expression of IgM under normal salt conditions (MFI = 20) compared to high salt conditions (MFI = 30). These data apparently contradict the previous findings, which suggest that high salt initially favors plasma cell differentiation, i.e., surface IgM was expected to disappear faster in high salt cultures. Hence, high surface abundance of IgM after 72 h suggests that less IgM is secreted, which is in line with our previous finding that high salt cultures contain less Blimp-1+ antibody-secreting plasmablasts.

Open in a separate window
Figure 3
Effect of increased NaCl concentrations on abundance of membrane bound IgM, IgH class switch recombination and antibody production in LPS blasts. (A) Abundance of membrane IgM on LPS-activated B cells with (HS) or without (NS) additional NaCl was analyzed by flow cytometry at indicated time points. Representative histograms show mean fluorescence intensity (MFI) of membrane IgM. The results are a summary of two independent experiments with a total of eight independent B cell isolates (N = 2, n = 8). (B) Freshly isolated B cells were cultured in the absence (Normal Salt) or presence (High Salt) of additional NaCl and activated with 10 μg/ml LPS and, 100 U/ml IL4 to induce switching to IgG1. After 48, 72, and 144 h, flow cytometric analysis of surface IgM and IgG1 was used to detect switched cells. Data was presented as frequency of switched cells per million cells. The results show the summary of two independent experiments with a total of five B cell isolates (N = 2, n = 5). (C) Cell culture supernatant was collected and concentration of IgM (LPS) and IgG1 (LPS + IL4) was determined by Enzyme-linked Immunosorbent Assay (ELISA). The results are a summary of two independent experiments with a total of five independent B cell isolates (N = 2, n = 5). Data are presented as the mean ± SEM. *p ≤ 0.05; **p ≤ 0.01; Mann-Whitney test.

To determine whether a change in salt concentrations affects the ability of LPS blasts to switch their Ig class from IgM to other isotypes, such as IgG1, normal and high salt cultures were supplemented with LPS and IL4 and analyzed for the presence of membrane IgG1 for 48, 72, and 144 h (Figure 3B). Frequencies of IgG1+ B cells in high salt cultures were decreased at all analyzed time points, with significant differences at 72 and 144 h compared to normal salt cultures. Under normal salt conditions, the number of membrane IgG1+ cells after 72 h was ~500,000, while in the high salt culture there was significantly less IgG1+ cells, i.e., merely 80,000 cells. These results indicate that an increase in osmolality impairs IgH class switch recombination (CSR) and limits, therefore, the Ig effector repertoire.

To assess the effect of increasing osmolality on antibody-secretion, supernatants from normal salt and high salt cultures were collected and analyzed for the concentration of secreted Igs by ELISA (Figure 3C). The amounts of secreted Igs per cell were calculated on the basis of total secreted amount of antibodies and numbers of live cells in cultures. After 48 h, cells in high salt cultures secreted significantly more secreted IgM per cell than cells under normal salt conditions, which was in line with increase in TACI+/CD138+ plasmablasts observed by flow cytometry in high salt cultures. However, after 72 h, the amount of secreted IgM per cell in normal and high salt cultures was comparable, indicating that longer exposure to high salt conditions leads to cell death of antibody-secreting plasmablasts. Moreover, the normal salt culture contained significantly more secreted IgG1 per cell after 72 h (Figure 3C). This reduction of IgG1 secretion under high salt conditions is in line with the class switch defect observed by flow cytometry in high salt cultures. In summary, time limited, short, exposure to high salt conditions favors B cell differentiation and antibody production, but impairs class switch recombination.

Hyperosmotic stress can activate p38, a mitogen-activated protein kinase (MAPK) upstream of NFAT5 and it is, therefore, involved in hypertonic activation of NFAT5 (23). It was shown that increased salt concentration enhances p38-dependent NFAT5 activation in CD4+ T cells and macrophages (7, 12). To assess whether an increase in osmolality in the cell culture medium upregulates NFAT5 expression in B cells, NFAT5 transcript abundance was analyzed by real-time PCR analysis in LPS blasts. Signals were analyzed by the ΔΔCT method and normalized to HPRT (Figure 4A). Relative NFAT5 expression after 48 h in culture under normal salt and high salt conditions was comparable. However, we observed an 8-fold and 4-fold increase in relative NFAT5 signals in high and normal salt after 72 h of culture, respectively. The 2-fold increase of NFAT5 expression in high salt cultures compared to normal salt cultures was significant. These results suggest that the impact of salt on LPS-induced NFAT5 expression occurs later in plasmablast differentiation.

Figure 4
Effect of increased NaCl concentrations on NFAT5 expression and p38/MAPK phosphorylation in activated mouse B cells. (A) Cells from 48 to 72 h of LPS cell culture in presence (High Salt) or absence (Normal Salt) of additional NaCl were harvested and RNA was isolated. After cDNA reaction, real-time qPCR was performed to determine expression of NFAT5 in given samples. Results present NFAT5 expression relative to HPRT (average ± SD). Four independent measurements were performed in three technical replicates for each sample. (B) After 72 h, LPS activated B cells from the Blimp-1:GFP reporter mouse in the presence (High Salt) or absence (Normal Salt) of additional NaCl and SB203580 were analyzed by flow cytometry for their CD138 and GFP expression. Two different populations according to their CD138 expression and GFP fluorescence are indicated as: Blimp-1:GFP+ (Blimp-1:GFP single positive cells and Blimp-1:GFP/CD138 positive cells) and CD138+ Blimp-1:GFP− (CD138 single positive cells). Frequency of cells was shown on representative dot plots. The results show the summary of two independent experiments with a total of five independent B cell isolates (N = 2, n = 5). Data are presented as the mean ± SEM. *p ≤ 0.05; Mann-Whitney test.

Furthermore, we analyzed whether p38 phosphorylation (p-p38) changed in B cells cultured in a normal salt or a high salt medium in the presence of LPS for 10 and 20 min by flow cytometry (Supplementary Figure 3). Normal salt cultures served as a positive control for the staining of a monoclonal antibody recognizing the phosphorylation of p38 at threonine residue T180 and tyrosine residue Y182. After 10 min, the mean fluorescence intensities (MFI) for phosphorylated p38 (p-p38) in normal salt cultures showed an increase from 250 in untreated cells to a MFI of 300; in contrast decrease of MFI from 250 to 220 was detected in high salt cultures. After 20 min, a significant difference in p-p38 fluorescence signal intensities between normal and high salt cultures was observed. At this time point, the intensity of the p-p38 signal in high salt cultures was even lower (MFI = 200) than the intensity measured after 10 min suggesting that high salt inhibits p38 phosphorylation and therefore, its activation. Increase in osmolality resulted in an inhibition of p38 phosphorylation and, therefore, activation and downstream signaling pathway in B cells.

To confirm that high salt indeed inhibits p38 activation, we used SB203580, a chemical inhibitor of p38/MAPK (24) and cultured freshly isolated splenic B cells from Blimp-1:GFP reporter mice 72 hours with LPS under normal salt and high salt conditions and in the presence of the SB203580 (Figure 4B). As previously shown, increased NaCl concentration led to accumulation of CD138+/Blimp-1:GFP− cells, but did not favor differentiation into Blimp-1+ antibody-secreting cells (Figure 2C). As expected, inhibitor-treated cultures showed a comparable phenotype in regards to Blimp-1:GFP and CD138 staining as seen in high salt cultures, i.e., the frequency of CD138+/Blimp-1:GFP− cells increased, while frequencies of Blimp-1:GFP+ cells were reduced in inhibitor-treated cultures to the same extend as they were in high salt cultures.

These results indicate that salt induces the inhibition of p-p38 activation, which might explain the inefficient differentiation into Blimp-1+ antibody-secreting cells under the high salt culture conditions.

Go to:
Discussion
Previous findings by Go and colleagues that lymphoid tissues are hyperosmotic compared to blood (9) established the basis for addressing osmoadaptive mechanisms in lymphocytes. The impact of environmental factors, such as hyperosmolality or osmotic stress caused by differences in salt concentrations in different lymphoid organs, on B cell activation is not well-understood. Here, we performed an in vitro study with the aim to elucidate the effect of increased osmolality caused by NaCl on B cell survival, activation and differentiation and demonstrated that B cell differentiation under increased osmolality can be divided into two phases (Supplementary Figure 4). In phase I the increase of osmolality boosts their activation and differentiation as demonstrated by PAX5 downregulation and corresponding CD138 upregulation. In phase II a stark decrease in cell growth is observed, which correspond to the increased cell death and the inhibition of proliferation. Cells from this point on decelerate their differentiation with more PAX5+ and less Blimp-1+ cells.

LPS-stimulated B cells undergo a massive proliferation and differentiation to antibody-secreting plasmablasts (25–27). Using a CFSE-based proliferation assay we demonstrated that increased NaCl leads to an accumulation of cells in cell division phases 0 and 1 after 48 h and phases 2, 3, and 4 after 72 h. High salt treated B cells do not reach the maximum number of cell divisions achieved by B cells in normal cell cultures indicating that proliferation is impaired or delayed by high salt. In parallel, we could confirm a reduction of cell growth and viability in primary splenic mouse B cells upon treatment with an additional +40 mM NaCl, which has been previously reported in different cell types, renal medullary cells (28), lymphocytes (29), thymocytes (30) and DT40 chicken B cells (31). Our study suggest that as osmotic stress persists, a substantial DNA damage caused by additional NaCl arrests the DNA reparation mechanism, which results in apoptosis of differentiated plasmablasts (32–35).

Using Blimp-1:GFP reporter mice an increase in the frequencies of CD138+/Blimp-1− cells was noted, which are presumably pre-plasmablasts (22). Their increase is independent of Blimp-1 expression (36), which suggests that NaCl enhances and fosters the initial activation signaling in B cells. This notion is strongly supported by a primary decrease of PAX5+ cells and upregulation of CD138 expression. Therefore, increased NaCl concentrations in B cell cultures boost the initial activation signals. We showed that osmotically stressed cells show high expression of membrane IgM, and an impaired class switch to IgG1. A initiation of CSR and AID induction depends on reduction of PI3K activity (37). Therefore, we speculate that excessive NaCl concentration increases PI3K activity upon B cell activation. This induces a regulatory signal through PI3K, possibly by suppressing the AID function and thus, suppressing CSR. It is also interesting to mention that PI3K signaling is necessary for p53-dependent induction by DNA damage (38, 39). PI3K-dependent p53 activity is therefore one potential mechanism for B cell response under osmotic stress.

Several publications in which hybridoma cells were cultured under increased osmolality presented evidence of increased antibody production (14–16). Along this line, our results demonstrated that primary LPS-activated B cells, cultured for a shorter period of time, produced significantly more IgM (Figure 3C).

Osmotic stress can activate mitogen-activated protein kinase (MAPK) p38 (23, 40) and is likely to play an important role in NFAT5 activation, acting as an upstream regulator in various cells, such as Jurkat cells (17), macrophages (7) and primary T cells (12). On the other hand, it has been shown that NFAT5 heterozygous mice (NFAT5+/Δ) have impaired antibody responses and reduced B cell proliferation in hypertonic medium (9). Here we demonstrate that B cells show a delayed upregulation of NFAT5 transcription as a response to osmotic stress compared to macrophages (10) and T cells (12). Go and colleagues demonstrated that osmolality in tissues such as spleen or thymus is elevated compared to blood. This implies that isolated B cells from the spleen already came from a hyperosmotic environment and were adapted to such conditions, while, contrary to them, newly generated plasmablasts are more sensitive to increased osmolality and therefore in higher demand for osmoadaptation. That assumption would explain the delayed NFAT5 upregulation observed in our experiments, resulting from increased NFAT5 expression in newly generated plasmablasts. However, this hypothesis needs to be confirmed using more sensitive techniques capable of measuring osmolality within different tissue compartments (i.e., germinal centers, B and T cell zone) and discriminating between intravascular and extravascular (interstitial) tissue fluid.

Contrary to the data published (23, 40), we found that high salt inhibits p38 signaling in B cells. Hence, normal salt B cell cultures activated p38, i.e., p38 has been phosphorylated upon LPS stimulation (41). That implies that LPS-dependent p38 activation is inhibited by NaCl. The chemical inhibition using SB203580 confirmed our conclusion: a decrease in antibody-secreting cells and an increase in CD138+ cells. Our results demonstrate that NFAT5 signaling in B cells is not dependent on p38 activation. This suggests that in osmotically stressed B cells, NFAT5 activity is, in contrast to T cells and macrophages, regulated by p38 independent mechanisms.

In summary, short term increase in osmolality fosters B cell activation and differentiation, but chronical exposure to NaCl dampens the initial boost of activation and differentiation and results in augmented cell death of differentiated cells. A deeper understanding of salt-dependent effects on B cell responses will be important to elucidate the functional role of micro-environmental salt in lymphoid tissues on B cell activation and the impact of dietary salt on adaptive immune responses, B cells malignancies and autoimmune diseases.

Go to:
Ethics Statement
This study was carried out in accordance with the German Law on Care and Use of Laboratory Animals. Euthanasia and organ preparation were approved by the local authorities (Landratsamt Erlangen-Hoechstadt, Erlangen, Germany).

Go to:
Author Contributions
LC designed the study, planned, and performed experiments, analyzed and interpreted data and wrote the manuscript. SP designed the study, interpreted data, and edited the manuscript. JT initiated the study and supported the work. H-MJ made key suggestions, assisted in the design of experiments, interpreted data and critically reviewed the manuscript. WS designed the study, planned experiments, analyzed and interpreted data and wrote and finalized the manuscript.

Conflict of Interest Statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Go to:
Footnotes
Funding. This work was supported in part, by the Deutsche Forschungsgemeinschaft (DFG) through the doctoral training program GRK1660 to H-MJ, through research grant TRR130 (project 09) to H-MJ and WS, the German Federal Ministry for Economics and Technology/DLR Forschung unter Weltraumbedingungen (50WB1624) and the Interdisciplinary Center for Clinical Research Erlangen to JT. We acknowledge support by Deutsche Forschungsgemeinschaft and Friedrich-Alexander-Universität Erlangen-Nürnberg (FAU) within the funding programme Open Access Publishing.

Go to:
Supplementary Material
The Supplementary Material for this article can be found online at: The Impact of Hyperosmolality on Activation and Differentiation of B Lymphoid Cells

Click here for additional data file.(1.5M, pdf)
Go to:
References
1. Gonzalez SF, Degn SE, Pitcher LA, Woodruff M, Heesters BA, Carroll MC. Trafficking of B cell antigen in lymph nodes. Ann Rev Immunol. (2011) 29:215–33. 10.1146/annurev-immunol-031210-101255 [PubMed] [CrossRef] [Google Scholar]
2. Okada T, Cyster JG. B cell migration and interactions in the early phase of antibody responses. Curr Opin Immunol. (2006) 18:278–85. 10.1016/j.coi.2006.02.005 [PubMed] [CrossRef] [Google Scholar]
3. Pereira JP, Kelly LM, Cyster JG. Finding the right niche: B-cell migration in the early phases of T-dependent antibody responses. Int Immunol. (2010) 22:413–9. 10.1093/intimm/dxq047 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
4. Mesin L, Ersching J, Victora GD. Germinal center B cell dynamics. Immunity. (2016) 45:471–82. 10.1016/j.immuni.2016.09.001 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
5. Victora GD, Schwickert TA, Fooksman DR, Kamphorst AO, Meyer-Hermann M, Dustin ML, et al. . Germinal center dynamics revealed by multiphoton microscopy with a photoactivatable fluorescent reporter. Cell. (2010) 143:592–605. 10.1016/j.cell.2010.10.032 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
6. Wiig H, Schröder A, Neuhofer W, Jantsch J, Kopp C, Karlsen TV, et al. . Immune cells control skin lymphatic electrolyte homeostasis and blood pressure. J Clin Invest. (2013) 123:2803–15. 10.1172/JCI60113 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
7. Jantsch J, Schatz V, Friedrich D, Schröder A, Kopp C, Siegert I, et al. . Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense. Cell Metabol. (2015) 21:493–501. 10.1016/j.cmet.2015.02.003 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
8. Schwartz L, Guais A, Pooya M, Abolhassani M. Is inflammation a consequence of extracellular hyperosmolarity? J Inflamm. (2009) 6:21. 10.1186/1476-9255-6-21 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
9. Go WY, Liu X, Roti MA, Liu F, Ho SN. NFAT5/TonEBP mutant mice define osmotic stress as a critical feature of the lymphoid microenvironment. Proc Natl Acad Sci USA. (2004) 101:10673–8. 10.1073/pnas.0403139101 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
10. Machnik A, Neuhofer W, Jantsch J, Dahlmann A, Tammela T, Machura K, et al. . Macrophages regulate salt-dependent volume and blood pressure by a vascular endothelial growth factor-C–dependent buffering mechanism. Nat Med. (2009) 15:545–52. 10.1038/nm.1960 [PubMed] [CrossRef] [Google Scholar]
11. Cheung CY, Ko BC. NFAT5 in cellular adaptation to hypertonic stress – regulations and functional significance. J Mol Signal. (2013) 8:5. 10.1186/1750-2187-8-5 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
12. Kleinewietfeld M, Manzel A, Titze J, Kvakan H, Yosef N, Linker RA, et al. . Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells. Nature. (2013) 496:518–22. 10.1038/nature11868 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
13. The International Multiple Sclerosis Genetics Consortium & The Wellcome Trust Case Control Consortium 2. Sawcer S, Hellenthal G, Pirinen M, Spencer CCA, Patsopoulos NA, et al. . Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. Nature. (2011) 476:214–9. 10.1038/nature10251 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
14. Reddy S, Bauer KD, Miller WM. Determination of antibody content in live versus dead hybridoma cells: analysis of antibody production in osmotically stressed cultures. Biotechnol Bioeng. (1992) 40:947–64. 10.1002/bit.260400811 [PubMed] [CrossRef] [Google Scholar]
15. Ryu JS, Lee GM. Effect of hypoosmotic stress on hybridoma cell growth and antibody production. Biotechnol Bioeng. (1997) 55:565–70. 10.1002/(SICI)1097-0290(19970805)55:3<565::AID-BIT14>3.0.CO;2-F [PubMed] [CrossRef] [Google Scholar]
16. Sun Z, Zhou R, Liang S, McNeeley KM, Sharfstein ST. Hyperosmotic stress in murine hybridoma cells: effects on antibody transcription, translation, posttranslational processing, and the cell cycle. Biotechnol Progr. (2004) 20:576–89. 10.1021/bp0342203 [PubMed] [CrossRef] [Google Scholar]
17. Kino T, Takatori H, Manoli I, Wang Y, Tiulpakov A, Blackman MR, et al. . Brx mediates the response of lymphocytes to osmotic stress through the activation of NFAT5. Sci Signal. (2009) 2:ra5. 10.1126/scisignal.2000081 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
18. Medvedovic J, Ebert A, Tagoh H, Busslinger M. Pax5: A Master regulator of B cell development and leukemogenesis. Adv Immunol. (2011) 111:179–206. 10.1016/B978-0-12-385991-4.00005-2 [PubMed] [CrossRef] [Google Scholar]
19. Schebesta A, McManus S, Salvagiotto G, Delogu A, Busslinger GA, Busslinger M. Transcription Factor Pax5 activates the chromatin of key genes involved in B cell signaling, adhesion, migration, and immune function. Immunity. (2007) 27:49–63. 10.1016/j.immuni.2007.05.019 [PubMed] [CrossRef] [Google Scholar]
20. Cobaleda C, Schebesta A, Delogu A, Busslinger M. Pax5: the guardian of B cell identity and function. Nat Immunol. (2007) 8:463–70. 10.1038/ni1454 [PubMed] [CrossRef] [Google Scholar]
21. Pracht K, Meinzinger J, Daum P, Schulz SR, Reimer D, Hauke M, et al. . A new staining protocol for detection of murine antibody-secreting plasma cell subsets by flow cytometry. Eur J Immunol. (2017) 47:1389–92. 10.1002/eji.201747019 [PubMed] [CrossRef] [Google Scholar]
22. Kallies A, Hasbold J, Tarlinton DM, Dietrich W, Corcoran LM, Hodgkin PD, et al. . Plasma cell ontogeny defined by quantitative changes in Blimp-1 expression. J Exp Med. (2004) 200:967–77. 10.1084/jem.20040973 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
23. Ko BCB, Lam AKM, Kapus A, Fan L, Chung SK, Chung SSM. Fyn and p38 signaling are both required for maximal hypertonic activation of the osmotic response element-binding protein/tonicity-responsive enhancer-binding protein (OREBP/TonEBP). J Biol Chem. (2002) 277:46085–92. 10.1074/jbc.M208138200 [PubMed] [CrossRef] [Google Scholar]
24. Young PR, McLaughlin MM, Kumar S, Kassis S, Doyle ML, McNulty D, et al. . Pyridinyl imidazole inhibitors of p38 mitogen-activated protein kinase bind in the ATP site. J Biol Chem. (1997) 272:12116–21. 10.1074/jbc.272.18.12116 [PubMed] [CrossRef] [Google Scholar]
25. Bucala R. Polyclonal activation of B lymphocytes by lipopolysaccharide requires macrophage-derived interleukin-1. Immunology. (1992) 77:477–82. [PMC free article] [PubMed] [Google Scholar]
26. Coutinho A, Gronowicz E, Bullock WW, Möller G. Mechanism of thymus-independent immunocyte triggering. J Exp Med. (1974) 139:74–92. 10.1084/jem.139.1.74 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
27. Dziarski R. Preferential induction of autoantibody secretion in polyclonal activation by peptidoglycan and lipopolysaccharide. II. In vivo studies. J Immunol. (1982) 128:6. [PubMed] [Google Scholar]
28. Michea L, Ferguson DR, Peters EM, Andrews PM, Kirby MR, Burg MB. Cell cycle delay and apoptosis are induced by high salt and urea in renal medullary cells. Am J Physiol Renal Physiol. (2000) 278:F209–18. 10.1152/ajprenal.2000.278.2.F209 [PubMed] [CrossRef] [Google Scholar]
29. Law P, Alsop P, Dooley DC, Meryman HT. Studies of cell separation: a comparison of the osmotic response of human lymphocytes and granulocyte-monocyte progenitor cells. Cryobiology. (1983) 20:644–51. 10.1016/0011-2240(83)90068-8 [PubMed] [CrossRef] [Google Scholar]
30. Bortner CD, Cidlowski JA. Absence of volume regulatory mechanisms contributes to the rapid activation of apoptosis in thymocytes. Am J Physiol Cell Physiol. (1996) 271:C950–61. 10.1152/ajpcell.1996.271.3.C950 [PubMed] [CrossRef] [Google Scholar]
31. Qin S, Minami Y, Kurosaki T, Yamamura H. Distinctive functions of Syk and Lyn in mediating osmotic stress- and ultraviolet c irradiation-induced apoptosis in chicken B cells. J Biol Chem. (1997) 272:17994–9. 10.1074/jbc.272.29.17994 [PubMed] [CrossRef] [Google Scholar]
32. Dmitrieva N, Michea L, Burg M. p53 Protects renal inner medullary cells from hypertonic stress by restricting DNA replication. Am J Physiol Renal Physiol. (2001) 281:F522–30. 10.1152/ajprenal.2001.281.3.F522 [PubMed] [CrossRef] [Google Scholar]
33. Dmitrieva NI, Cai Q, Burg MB. Cells adapted to high NaCl have many DNA breaks and impaired DNA repair both in cell culture and in vivo. Proc Natl Acad Sci USA. (2004) 101:2317–22. 10.1073/pnas.0308463100 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
34. Dmitrieva NI, Cui K, Kitchaev DA, Zhao K, Burg MB. DNA double-strand breaks induced by high NaCl occur predominantly in gene deserts. Proc Natl Acad Sci USA. (2011) 108:20796–801. 10.1073/pnas.1114677108 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
35. Roos WP, Kaina B. DNA damage-induced cell death by apoptosis. Trends Mol Med. (2006) 12:440–50. 10.1016/j.molmed.2006.07.007 [PubMed] [CrossRef] [Google Scholar]
36. Kallies A, Hasbold J, Fairfax K, Pridans C, Emslie D, McKenzie BS, et al. . Initiation of plasma-cell differentiation is independent of the transcription factor blimp-1. Immunity. (2007) 26:555–66. 10.1016/j.immuni.2007.04.007 [PubMed] [CrossRef] [Google Scholar]
37. Omori SA, Cato MH, Anzelon-Mills A, Puri KD, Shapiro-Shelef M, Calame K, et al. . Regulation of class-switch recombination and plasma cell differentiation by phosphatidylinositol 3-kinase signaling. Immunity. (2006) 25:545–57. 10.1016/j.immuni.2006.08.015 [PubMed] [CrossRef] [Google Scholar]
38. Bar J, Lukaschuk N, Zalcenstein A, Wilder S, Seger R, Oren M. The PI3K inhibitor LY294002 prevents p53 induction by DNA damage and attenuates chemotherapy-induced apoptosis. Cell Death Differ. (2005) 12:1578–87. 10.1038/sj.cdd.4401677 [PubMed] [CrossRef] [Google Scholar]
39. Lee C, Kim J-S, Waldman T. Activated PI3K signaling as an endogenous inducer of p53 in human cancer. Cell Cycle. (2007) 6:394–6. 10.4161/cc.6.4.3810 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
40. Zhou X. Regulation of tonicity-dependent activation of NFAT5 by mitogen-activated protein kinases. Abdomen. (2015) 2:e767 10.14800/Abdomen.767 [CrossRef] [Google Scholar]
41. Han J, Lee J, Bibbs L, Ulevitch R. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science. (1994) 265:808–11. 10.1126/science.7914033 [PubMed] [CrossRef] [Google Scholar]

 

[Tristan Loscha]

-

 

[Tristan Loscha]

PLoS Biol. 2020 Jun; 18(6): e3000722.
Published online 2020 Jun 22. doi: 10.1371/journal.pbio.3000722
PMCID: PMC7307728
PMID: 32569301
NCX1 represents an ionic Na+ sensing mechanism in macrophages
Patrick Neubert, Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing,#1 Arne Homann, Conceptualization, Data curation, Investigation, Methodology, Writing – review & editing,#1 David Wendelborn, Conceptualization, Data curation, Investigation, Methodology, Writing – review & editing,#1 Anna-Lorena Bär, Data curation, Investigation, Methodology, Writing – review & editing,1 Luka Krampert, Investigation, Methodology, Writing – review & editing,1 Maximilian Trum, Formal analysis, Investigation, Methodology, Writing – review & editing,2 Agnes Schröder, Conceptualization, Data curation, Investigation, Methodology, Writing – review & editing,3 Stefan Ebner, Investigation, Methodology, Writing – review & editing,1,4 Andrea Weichselbaum, Investigation, Methodology, Writing – review & editing,1 Valentin Schatz, Conceptualization, Investigation, Methodology, Supervision, Writing – review & editing,1 Peter Linz, Data curation, Formal analysis, Investigation, Methodology, Resources, Supervision, Validation, Writing – review & editing,5 Roland Veelken, Conceptualization, Methodology, Resources, Supervision, Writing – review & editing,6 Jonas Schulte-Schrepping, Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – review & editing,7 Anna C. Aschenbrenner, Investigation, Methodology, Visualization, Writing – review & editing,7,8 Thomas Quast, Investigation, Methodology, Resources, Writing – review & editing,9 Christian Kurts, Conceptualization, Methodology, Writing – review & editing,10 Sabrina Geisberger, Investigation, Methodology, Writing – review & editing,11,12 Karl Kunzelmann, Conceptualization, Methodology, Writing – review & editing,13 Karin Hammer, Conceptualization, Methodology, Resources, Supervision, Writing – review & editing,2 Katrina J. Binger, Conceptualization, Supervision, Visualization, Writing – original draft, Writing – review & editing,14 Jens Titze, Conceptualization, Methodology, Resources, Writing – review & editing,15 Dominik N. Müller, Conceptualization, Funding acquisition, Supervision, Writing – review & editing,11,12 Waldemar Kolanus, Conceptualization, Methodology, Resources, Supervision, Writing – review & editing,9 Joachim L. Schultze, Conceptualization, Data curation, Methodology, Resources, Writing – review & editing,7,16 Stefan Wagner, Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Resources, Supervision, Validation, Visualization, Writing – original draft, Writing – review & editing,2 and Jonathan Jantsch, Conceptualization, Formal analysis, Funding acquisition, Investigation, Methodology, Project administration, Resources, Supervision, Visualization, Writing – original draft, Writing – review & editing1,*
Paula M. Oliver, Academic Editor
Author information Article notes Copyright and License information Disclaimer
Associated Data
Supplementary Materials
Data Availability Statement
Go to:
Abstract
Inflammation and infection can trigger local tissue Na+ accumulation. This Na+-rich environment boosts proinflammatory activation of monocyte/macrophage-like cells (MΦs) and their antimicrobial activity. Enhanced Na+-driven MΦ function requires the osmoprotective transcription factor nuclear factor of activated T cells 5 (NFAT5), which augments nitric oxide (NO) production and contributes to increased autophagy. However, the mechanism of Na+ sensing in MΦs remained unclear. High extracellular Na+ levels (high salt [HS]) trigger a substantial Na+ influx and Ca2+ loss. Here, we show that the Na+/Ca2+ exchanger 1 (NCX1, also known as solute carrier family 8 member A1 [SLC8A1]) plays a critical role in HS-triggered Na+ influx, concomitant Ca2+ efflux, and subsequent augmented NFAT5 accumulation. Moreover, interfering with NCX1 activity impairs HS-boosted inflammatory signaling, infection-triggered autolysosome formation, and subsequent antibacterial activity. Taken together, this demonstrates that NCX1 is able to sense Na+ and is required for amplifying inflammatory and antimicrobial MΦ responses upon HS exposure. Manipulating NCX1 offers a new strategy to regulate MΦ function.

Go to:
Introduction
Infection and inflammation can trigger localized accumulation of sodium (Na+) in skin [1–3]. This accumulation is similar to that induced by high-Na+–containing diets and increases the effective osmolyte concentration within the skin to more than 40 mM above that of normal, isotonic blood [1,4].

Although blood Na+ is tightly regulated by the kidney, it has been established that monocyte/macrophage-like cells (MΦs) are necessary for the clearance of skin electrolytes upon dietary high-salt (HS) challenges [4,5]. However, the precise molecular mechanisms that orchestrate Na+ accumulation in the skin remain elusive, clearance by MΦs requires the osmoprotective transcription factor nuclear factor of activated T cells 5 (NFAT5) [4,6], which is the calcineurin-independent member of the NFAT family (reviewed in [7,8]).

In addition to regulating skin Na+ levels, the response of MΦs to infection and/or inflammation is modulated by increased local Na+ levels. Increases in Na+ limit anti-inflammatory regulatory MΦ activation while amplifying proinflammatory and antimicrobial activity [1,9–15]. We have shown that high Na+ increases NFAT5-dependent nitric oxide synthase 2 (Nos2) expression in lipopolysaccharide (LPS)-activated MΦs, resulting in increased antimicrobial nitric oxide (NO) production. High-Na+ conditions also enhanced autolysosome formation of infected MΦs, which together with increased NO, ultimately facilitates increased antimicrobial responses [1,10]. Although these findings established that alterations in local Na+ influence MΦ biology, the initial molecular responses of MΦs to high-Na+ environments remain unclear.

Here, we demonstrate that exposure to high extracellular Na+ stimulates the MΦ Na+/Ca2+ exchanger 1 (NCX1, also known as solute carrier family 8 member A1 [SLC8A1]), resulting in Na+ influx and Ca2+ efflux. We show that these NCX1-dependent currents are required for Na+-increased proinflammatory MΦ activity. Altogether, this study identifies a new molecule important for MΦs to sense increases in local Na+ levels and regulate their biology.

Go to:
Results
Elevated extracellular Na+ triggers Na+ influx into MΦs
The elevated levels of extracellular skin Na+ can be mimicked in vitro by the addition of 40 mM NaCl to standard cell culture media [1,4,10,11]. We exposed MΦs to increased extracellular Na+ (+40 mM NaCl; +80 mOsm/kg; HS). Chemical analysis of Na+ content revealed that HS substantially increased cellular Na+ levels compared with normal salt (NS) in an LPS-independent manner (Fig 1A). To monitor intracellular Na+ in situ ([Na+]i), we used MΦs loaded with the Na+-sensitive dye sodium-binding benzofuran isophthalate (SBFI). LPS stimulation alone did not alter [Na+]i. HS exposure, however, resulted in an immediate increase in [Na+]i in the absence or presence of LPS (Fig 1B). Of note, the osmolality control urea did not trigger substantial Na+ entry into MΦs (Fig 1C).

Fig 1
HS conditions induce rapid Na+ influx in MΦs.
(A) Total Na+ content of RAW264.7 MΦs ± 10 ng/ml LPS under NS or HS (NS + 40 mM NaCl) conditions (mean ± SD; n = 11–12; Student t test ± Welch correction; *p < 0.05). (B) Relative [Na+]i of RAW264.7 MΦs. Traces of RAW264.7 MΦs stimulated with HS, LPS, or both at t = 10 s (mean ± SD; n = 7–9). (C) Relative [Na+]i of RAW264.7 MΦs. Traces of RAW264.7 MΦs stimulated with HS or 80 mM urea at t = 10 s (mean ± SD; n = 5). For numerical raw data, please see S1 Data. HS, high salt; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; [Na+]i, intracellular Na+ in situ; NS, normal salt.

We hypothesized that one (or more) proteins at the plasma membrane might mediate HS-triggered Na+ influx. A query in the ImmGen database [16] revealed that mouse MΦs express transcripts for several ion channels, exchangers, and transporters, which are able to facilitate Na+ entry. This list includes the epithelial Na+ channel 1 alpha subunit, Na+/H+ antiporter, the voltage-gated Na+ channel, acid-sensing ion channels, Na+-K+-Cl− symporter, and NCX1 (Slc8a1). In addition, HS-triggered signaling might also depend on transient receptor potential cation channel subfamily V member 4 (TRPV4). To measure whether Na+ influx by one of these molecules is involved in HS-boosted inflammatory (i.e., LPS-induced) MΦ activation, we used selective inhibitors targeting these molecules (S1 Table) and quantified NO production. Because HS alone (in the absence of LPS) does not induce NO production (Fig 2), as described earlier [1,10], we used MΦs stimulated with LPS in the presence of HS for this screening purpose (Fig 2). Conforming to our earlier findings [1,10], HS increased LPS-triggered NO release, whereas the osmolality control urea did not (Fig 2). The various inhibitors (S1 Table) revealed that only exposure to the NCX inhibitors KB-R7943 mesylate (KB-R) [17], SEA 0400 (SEA) [18], and NiCl2 [19] impaired HS-increased NO production in LPS-stimulated MΦs (Fig 2). Of note, these NCX inhibitors did not trigger NO production in the absence of LPS (S1 Fig).

Fig 2
NCX inhibitors abrogate HS-boosted NO production of LPS-stimulated MΦs.
Lower panel: nitrite levels of RAW264.7 MΦs pretreated with indicated inhibitors and stimulated ± LPS ± HS or 80 mM urea (mean ± SD; n = 9; Student t test or Mann–Whitney test; *p < 0.05). Upper panel: changes of means in nitrite production upon indicated stimulation and/or treatment (Δ nitrite). For numerical raw data, please see S1 Data. HS, high salt; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; NCX, Na+/Ca2+ exchanger; NO, nitric oxide; NS, normal salt; n.s., not significant.

MΦs are known to express NCX [20], of which NCX1 and NCX3 are expressed in human MΦs [21]. A query of the ImmGen database [16] revealed that NCX1 (Scl8a1) is robustly expressed in mouse MΦs, whereas there was minimal expression of Scl8a2 (the gene coding for NCX2) and Scl8a3 (NCX3). These findings were confirmed by quantitative real-time PCR (qRT-PCR) analysis of mouse MΦs (Fig 3A). There are several Slc8a1 splice variants known (reviewed in [22]). To determine the dominantly expressed variant (Fig 3B), we analyzed RNA sequencing (RNA-seq) data of bone marrow–derived MΦs (BMDMs). Transcriptome assembly identified two additional transcript variants (Fig 3B, red). Transcript abundance estimation revealed dominant expression of one novel variant (StringTie Assembly version 1), which skipped an internal exon and featured an additional 5′ exon upstream of the open reading frame (ORF), representing an alternative untranslated region (UTR). This novel Slc8a1 variant has not been annotated in the standard GENCODE version M10 or RefSeq catalog, but it has been independently predicted by the National Center for Biotechnology Information (NCBI) eukaryotic gene prediction tool Gnomon under XM_006523944 (Fig 3B, blue).

Fig 3
MΦs express a novel Slc8a1 splice variant.
(A) A representative real-time amplification plot of Slc8a1, Slc8a2, and Slc8a3 in BMDMs, RAW264.7 MΦs, and brain tissue out of two experiments. (B) Shown are the alignments of RNA-seq reads of BMDMs and their coverage with annotated (gray; GENCODE: ENSMUST00000086538.9, ENSMUST00000163123.1, ENSMUST00000163680.8), predicted (blue; RefSeq PREDICTED: XM_006523944), and StringTie-assembled (red; StringTie Assembly version 1, StringTie Assembly version 2) Slc8a1 splice variants. For numerical raw data, please see S1 Data. The RNA-seq data can be found in the GEO database (https://www.ncbi.nlm.nih.gov) under accession number GSE136662. BMDM, bone marrow–derived MΦ; GEO, Gene Expression Omnibus; MΦ, monocyte/macrophage-like cell; RNA-seq, RNA sequencing; Slc8, solute carrier family 8.

Increases in extracellular Na+ stimulate MΦ NCX currents
To explore the functional role of NCX in HS-increased inflammatory MΦ activation, we assessed whole-cell currents (whole-cell voltage clamp) of MΦ as a function of the membrane potential (Vm). The HS-sensitive current, determined as the difference between the current in the presence and absence of HS, showed increased inward currents (Fig 4A, left panel), suggesting influx of positively charged ions upon HS exposure. As published earlier [23,24], we found that the LPS-sensitive current, determined as the difference between the current in the presence and absence of LPS, showed outward rectification at positive Vm (Fig 4A, middle panel). By contrast, exposure of MΦ to LPS in the presence of HS reduced outward currents and increased inward currents (Fig 4A, right panel). Overall, this is consistent with HS triggering the influx of positively charged ions at negative Vm and reduced net efflux at positive Vm. In a separate set of experiments, we used NiCl2 to block NCX currents rapidly. NiCl2 pretreatment abolished HS-triggered inward currents (Fig 4B, left panel). However, NiCl2 treatment prior to LPS stimulation did not affect the outward rectification of the LPS-sensitive currents at positive Vm (Fig 4B, middle panel). Again, NiCl2 treatment prior to stimulation with LPS and HS abrogated HS-triggered increased inward currents but did not affect the LPS-sensitive currents at positive Vm (Fig 4B, right panel).

Fig 4
HS exposure results in NCX-mediated inward currents.
(A) Current/voltage relationships of MΦ ± LPS ± HS. Whole-cell VC experiments were performed before and after stimulation of BMDMs. Voltage steps were applied, and differential currents (IHS, ILPS, ILPS+HS) were plotted (mean ± 95% CI; n = 10–13). (B) As in (A), but with NiCl2 pretreatment (means ± 95% CI; n = 10). (C) Current/voltage relationships of BMDMs stimulated with LPS ± HS followed by NiCl2 treatment. Whole-cell VR experiments were performed, and Ni-sensitive (i.e., NCX-sensitive) currents (INCX) were determined (means ± 95% CI; n = 9). (D) ErevNCX (means ± SD; n = 9; Mann–Whitney test; *p < 0.05). (E) Resting Vm of BMDMs (means ± SD; n = 36). For numerical raw data, please see S1 Data. BMDM, bone marrow–derived MΦ; ErevNCX, NCX reversal potential; HS, high salt; I, current; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; NCX, Na+/Ca2+ exchanger; VC, voltage clamp; Vm, membrane potential; VR, voltage ramp.

In order to analyze NCX currents directly, we measured the total current of LPS- and LPS + HS–treated MΦs before and after addition of NiCl2. The Ni-sensitive current, determined as the difference between the current in the absence and presence of NiCl2, was used as a direct measure of NCX current. Compared with LPS alone, at Vm values negative from the NCX reversal potential (Erev), additional HS exposure enhanced NCX inward current (Fig 4C). Altogether, this suggests that NCX mediates Na+ entry. Moreover, HS exposure shifted the ErevNCX from −20.9 mV to −7.6 mV, consistent with the increased electrochemical gradient for Na+ ions upon HS (Fig 4D).

Since the forward mode of the NCX exchange activity can only occur at Vm negative of Erev [25], we measured the resting Vm in untreated and LPS-stimulated MΦs by whole-cell patch clamp technique (current clamp). In line with earlier publications [26–30], we detected a Vm of −18.7 mV in resting MΦs (Fig 4E), which did not significantly change upon LPS stimulation (S2 Fig). Under NS and LPS conditions, this resting Vm is very close to the ErevNCX. This incapacitates NCX-mediated currents to occur in LPS-treated MΦs under NS conditions; however, with HS exposure, it shifts the Erev into positive directions (Fig 4D), generating the driving force for forward-mode NCX inward currents to occur.

Increases in extracellular Na+ result in Ca2+ loss
In its forward mode, NCX not only allows for Na+ entry but extrudes Ca2+ in exchange (reviewed in [22,31]). Accordingly, we hypothesized that a rapid efflux of Ca2+ from MΦs may accompany the HS-triggered increase in [Na+]i. Therefore, we analyzed the emitted fluorescence of Fura-2–loaded MΦs as a measure of intracellular Ca2+ in situ ([Ca2+]i) (Fig 5A and 5B). In accordance with previous publications [32–34], there was no long-lasting increase in [Ca2+]i upon LPS stimulation under NS in MΦs (Fig 5B). Exposure to HS in the absence or presence of LPS stimulation, however, resulted in a rapid decrease of [Ca2+]i (Fig 5A and 5B). We confirmed these results using flow cytometry–based analysis after staining with the Ca2+-sensitive dyes Fluo-3 and Fura-Red. Again, upon HS exposure in the absence of presence of LPS, we noted a rapid decrease of [Ca2+]i, which inversely mirrored the increase of [Na+]i (Fig 5C and 5D). This further supports the notion that a single exchange mechanism may contribute to HS-triggered Na+ influx and Ca2+ loss in MΦs.

Fig 5
HS exposure causes Ca2+ loss.
(A) Relative [Ca2+]i levels of RAW264.7 MΦs. Traces of Fura-2–loaded RAW264.7 MΦs stimulated ± HS at t = 10 s (mean ± SD; n = 6). Where indicated, Tg was added (means ± SD; n = 2). (B) As in (A), but RAW264.7 MΦs were stimulated with LPS ± HS at t = 10 s (mean ± SD; n = 5). Where indicated, Tg was added (means ± SD; n = 2). (C) As in (A), but relative [Ca2+]i levels were assessed in Fluo-3/Fura-Red–loaded MΦs (means ± SD; n = 6). (D) As in (B), but relative [Ca2+]i levels were assessed in Fluo-3/Fura-Red–loaded MΦs (means ± SD; n = 8). For numerical raw data, please see S1 Data. [Ca2+]i, intracellular Ca2+ in situ; HS, high salt; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; Tg, thapsigargin.

To assess whether HS-dependent decreases in [Ca2+]i were mediated by increased uptake into intracellular stores, we exposed MΦs to thapsigargin (Tg, an inhibitor of the endoplasmic reticulum Ca2+-ATPase; reviewed in [35]) at the end of the experiments. Tg treatment resulted in a transient release of Ca2+ from intracellular stores, leading to an increase in [Ca2+]i (Fig 5A, 5B, 5C and 5D). Importantly, HS exposure did not abolish the Tg-dependent Ca2+ release, suggesting that changes in Ca2+ uptake into intracellular stores upon HS exposure are not involved.

Pharmacological inhibition of NCX interferes with HS-boosted MΦ function
To further corroborate these findings, we used KB-R at a concentration known to inhibit the NCX forward mode (reviewed in [36]) and measured the HS-dependent changes in [Na+]i and [Ca2+]i in the absence or presence of LPS. KB-R treatment did not impair MΦ viability (S3 Fig) but blunted HS-triggered Na+ entry in the absence or presence of LPS (Fig 6A and 6B). This was paralleled by abrogated HS-mediated changes in [Ca2+]i (Fig 6C and 6D).

Fig 6
Pharmacological inhibition of NCX activity blunts HS-triggered Na+ influx and Ca2+ loss.
(A) Relative [Na+]i levels in RAW264.7 MΦs. Traces of RAW264.7 MΦs stimulated ± HS (at t = 10 s) ± KB-R pretreatment (means ± SD; n = 4–8). (B) Relative [Na+]i levels in RAW264.7 MΦs. Traces of RAW264.7 MΦs stimulated with LPS ± HS (at t = 10 s) ± KB-R pretreatment (means ± SD; n = 5–8). (C) As in (A), but relative [Ca2+]i levels were assessed in Fura-2–loaded MΦs (means ± SD; n = 5–8). (D) As in (B), but relative [Ca2+]i levels were assessed in Fura-2–loaded MΦs (means ± SD; n = 6–8). For numerical raw data, please see S1 Data. [Ca2+]i, intracellular Ca2+ in situ; HS, high salt; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; KB-R, KB-R7943 mesylate; [Na+]i, intracellular Na+ in situ; NCX, Na+/Ca2+ exchanger.

Importantly, KB-R treatment interfered with HS-induced NFAT5 expression in the absence (S4A Fig) or presence of LPS stimulation (Fig 7A). In LPS-treated MΦs, this was paralleled by suppression of HS-boosted expression of the Nfat5 target gene Nos2 (Fig 7B), which is in line with the reduced effect of HS on LPS-induced NO production. (Fig 2). We additionally used NiCl2 and SEA to interfere with NCX activity. Again, these inhibitors did not affect MΦ viability (S3 Fig). NiCl2 treatment diminished HS-induced NFAT5 in the absence (S4B Fig) or presence of LPS (Fig 7C). NiCl2 abolished HS-augmented expression of Nos2 in LPS-stimulated MΦs (Fig 7D). Likewise, SEA interfered with HS-induced NFAT5 levels in the absence (S4C Fig) or presence of LPS (Fig 7E) and subsequently boosted Nos2 expression (Fig 7F).

Fig 7
Pharmacological inhibition of NCX activity blocks HS-boosted MΦ activity.
(A) Immunoblotting and densitometry of NFAT5 6 h after LPS ± HS in RAW264.7 MΦs ± KB-R pretreatment (n = 3; paired t test; *p < 0.05). (B) Nos2 levels in RAW264.7 MΦs 4 h after LPS ± HS ± KB-R pretreatment (means ± SD; n = 10; Student t test; *p < 0.05). (C) Immunoblotting and densitometry of NFAT5 in RAW264.7 MΦs 4 h after LPS ± HS ± NiCl2 pretreatment (n = 4; paired t tests; *p < 0.05). (D) Nos2 levels in RAW264.7 MΦs 4 h after LPS ± HS ± NiCl2 pretreatment (means ± SD; n = 6; Student t test + Welch correction; *p < 0.05). (E) Immunoblotting and densitometry of NFAT5 in RAW264.7 MΦs 4 h after LPS ± HS ± SEA pretreatment (n = 5; paired t test; *p < 0.05). (F) Nos2 in RAW264.7 MΦs 4 h after LPS ± HS ± SEA pretreatment (means ± SD; n = 10–12; Mann–Whitney test; *p < 0.05). (G) RFP-GFP-mLC3 RAW264.7 MΦs were infected with Escherichia coli ± HS ± SEA pretreatment. Representative images 2 h after infection (RFP: red; GFP: green; scale bar: 10 μm). (H) Relative E. coli load at 2 h after infection of RAW264.7 MΦs ± HS ± SEA pretreatment (means ± SD; n = 12; Student t tests; *p < 0.05). For numerical raw data, please see S1 Data. For raw immunoblots, please see S1 Blots. CFU, colony forming unit; GFP, green fluorescent protein; HS, high salt; KB-R, KB-R7943 mesylate; LPS, lipopolysaccharide; mLC3, microtubule-associated protein 1 light chain 3; MΦ, monocyte/macrophage-like cell; NCX, Na+/Ca2+ exchanger; NFAT5, nuclear factor of activated T cells 5; Nos2, nitric oxide synthase 2; NS, normal salt; n.s., not significant; RFP, red fluorescent protein; SEA, SEA 0400.

In addition to increasing Nos2 expression, HS-induced Nfat5 expression facilitates autolysosome formation upon infection, which is critically required for HS-boosted antibacterial activity directed against E. coli [10]. To test the impact of NCX inhibition on autolysosome formation, we used SEA in MΦs that express the tandem monomeric red fluorescent protein (RFP)-green fluorescent protein (GFP)–tagged microtubule-associated protein 1 light chain 3 (mLC3). Because GFP fluorescence is pH sensitive, GFP+RFP+ vesicles indicate autophagosomes, whereas GFP−RFP+ vacuoles mark degradative, acidified autolysosomes [37]. In accordance with our previous findings [10], HS exposure boosted the formation of autolysosomes in controls; however, in NCX-inhibited cells, HS failed to increase autolysosome formation, indicating disturbed autophagy (Fig 7G). Building on our earlier findings that HS-boosted antibacterial activity hinges on increased autophagy [10], NCX inhibition incapacitated the effect of HS on antibacterial activity (Fig 7H).

Silencing of Slc8a1 abrogates HS-amplified MΦ function
Next, we used RNA interference (RNAi) to target NCX1 expression in MΦs. Transfer of Slc8a1-specific small interfering RNA (siRNA) reduced Slc8a1 mRNA levels in the absence (S5 Fig) and presence of LPS (Fig 8A). This was paralleled by diminished membranous expression of NCX1 (Fig 8B). Analysis of Ni-sensitive currents in Slc8a1-silenced MΦs upon HS exposure revealed that targeting Slc8a1 diminished Ni-sensitive inward currents (S6 Fig). Because Ni-sensitive currents represent NCX currents, this suggests that silencing of Slc8a1 is functional. Conforming to our pharmacological inhibitor data (Fig 6), silencing of Slc8a1 strongly reduced HS-triggered increase in [Na+]i (Fig 8C). Consistently, in this situation, HS failed to lower [Ca2+]i (Fig 8D).

Fig 8
Slc8a1 silencing decreases Na+ influx and Ca2+ efflux.
(A) Slc8a1 and (B) membranous NCX1 expression in LPS-stimulated ns or Slc8a1-specific siRNA–treated BMDMs after 4 h (means ± SD; n = 8; Mann–Whitney test; *p < 0.05). (C) Relative [Na+]i levels of ns siRNA and Slc8a1 siRNA–treated BMDMs exposed to LPS ± HS at t = 10 s (means ± SD; n = 5–7). (D) Relative [Ca2+]i levels in ns siRNA and Slc8a1 siRNA–treated BMDMs exposed to LPS ± HS at t = 10 s (means ± SD; n = 6–11). For numerical raw data, please see S1 Data. For raw immunoblots, please see S1 Blots. BMDM, bone marrow–derived MΦ; [Ca2+]i, intracellular Ca2+ in situ; HS, high salt; LPS, lipopolysaccharide; [Na+]i, intracellular Na+ in situ; ns, nonsilencing; NCX, Na+/Ca2+ exchanger; siRNA, small interfering RNA; Slc8, solute carrier family 8.

In line with this, Slc8a1-specific siRNA largely diminished the effect of Na+-induced NFAT5 protein levels in the absence (S7A Fig) and presence of LPS (Fig 9A). Silencing of Slc8a1 under NS conditions did not induce NO production (S7B Fig). In LPS-activated MΦs, Slc8a1 silencing abolished HS-triggered increases in Nos2 mRNA expression (Fig 9B) and reduced HS-augmented NO production (Fig 9C). Finally, Slc8a1 silencing abrogated HS-boosted autolysosome formation (Fig 9D) and subsequent antimicrobial activity (Fig 9E).

Open in a separate window
Fig 9
Slc8a1 silencing abrogates HS-augmented MΦ activity.
(A) ns siRNA and Slc8a1 siRNA RAW264.7 were treated with LPS ± HS. Representative NFAT5 and ACTIN immunoblot 4 h after stimulation from two experiments. (B) As in (A), but Nos2 in BMDMs 4 h after LPS ± HS (means ± SD; n = 6; Mann–Whitney test; *p < 0.05). (C) As in (B), but Δ nitriteHS LPS-LPS after 24 h (means ± SD; n = 8; Student t test). (D) ns siRNA and Slc8a1 siRNA–treated RFP-GFP-mLC3 RAW264.7 MΦs were infected with E. coli ± HS. Representative images 2 h after infection from three experiments (RFP: red; GFP: green; scale bar: 10 μm). (E) ns siRNA and Slc8a1 siRNA–treated BMDMs were infected with E. coli ± HS. E. coli load at 2 h infection (means ± SD; n = 12; Student t tests; *p < 0.05). For numerical raw data, please see S1 Data. For raw immunoblots, please see S1 Blots. BMDM, bone marrow–derived MΦ; CFU, colony forming unit; GFP, green fluorescent protein; HS, high salt; LPS, lipopolysaccharide; mLC3, microtubule-associated protein 1 light chain 3; MΦ, monocyte/macrophage-like cell; NFAT5, nuclear factor of activated T cells 5; Nos2, nitric oxide synthase 2; NS, normal salt; ns, nonsilencing; n.s., not significant; RFP, red fluorescent protein; siRNA, small interfering RNA; Slc8, solute carrier family 8.

Overall, the RNAi experiments corroborate our pharmacological inhibition experiments and demonstrate that NCX1-dependent signaling is critical for HS-boosted inflammatory and antimicrobial response (Fig 10).

Open in a separate window
Fig 10
Graphical summary.
NCX1 is required for Na+ entry and Ca2+ loss upon exposure of MΦs to HS conditions. In LPS-stimulated MΦs, NCX1 is required for HS-boosted NFAT5 accumulation and NO production. Moreover, NCX1 is required for enhanced autolysosome formation and bacterial removal upon HS exposure. HS, high salt; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; NCX, Na+/Ca2+ exchanger; NFAT5, nuclear factor of activated T cells 5; NO, nitric oxide.

Go to:
Discussion
In addition to organic chemical signals, the local ionic inorganic tissue microenvironment is now recognized as a novel regulator of immune cell function (reviewed in [38–40]). We and others have demonstrated earlier that local Na+ imbalances are able to influence immune cell activation and to boost MΦ activation. HS amplification of MΦ activation hinges on signal molecules such as p38/mitogen-activated protein kinase, NFAT5, and mitochondrial reactive oxygen species (ROS) production, which play an important role in both adaption to osmotic stress and innate cell activation [12,41–45]. However, upstream LPS-independent mechanisms linking increased external Na+ to altered MΦ activation remained unknown.

In the present study, we show that exposure of MΦs to HS resulted in an immediate rapid increase in intracellular Na+. We investigated several Na+ entry pathways on their impact on HS-dependent MΦ stimulation. In line with earlier findings [15], we did not detect a contribution of voltage-gated Na+ channels. Moreover, our data demonstrate that amiloride-sensitive Na+ channels are not involved in HS-boosted MΦs. The latter have been implicated in microglia/MΦ function (reviewed in [46]) and Na+ sensing of dendritic cells [47]. In contrast, we show here that in MΦs, NCX1 contributes to Na+ entry and subsequent signaling that ultimately results in increased MΦ antimicrobial function upon HS exposure.

The increase of external Na+ from 140 mM to approximately 180 mM appears to result in a relatively small increase in the electrochemical gradient for Na+ across the membrane. Our data suggest that the plasma membrane of MΦs displays a high permeability for Na+ ions. Because the ErevNCX of LPS-treated MΦs matched the Vm of resting and LPS-stimulated MΦs, NCX currents are incapacitated under NS conditions. By contrast, the small increase in the electrochemical Na+ gradient upon HS treatment shifts the ErevNCX approximately 10 mV in the positive direction. Altogether, this facilitates the forward-mode activity of NCX, ultimately allowing Na+ cellular entry in exchange for Ca2+ efflux. Concordantly, we found a decrease in intracellular Ca2+. Considering the reported stoichiometric ratio of 3:1 for Na+/Ca2+ exchange (reviewed in [22]), a net movement of positive charges into the cell should rapidly depolarize the Vm of MΦs. Increases in intracellular Na+ and decreases in intracellular Ca2+ would rapidly reduce the driving force for NCX and incapacitate NCX currents again.

In accordance with others [32–34], we did not detect any long-lasting increases of [Ca2+]i in MΦs exposed to LPS under NS, indicating that MΦs do not require such increases for their proinflammatory activity. This is in stark contrast to other cells, such as T cells (reviewed in [48]). Westphalen and colleagues reported that Ca2+ entry in alveolar MΦs through connexin 43–dependent interconnections from alveolar epithelial cells suppresses the inflammatory capacity of these MΦs [49]. Moreover, increases in intracellular Ca2+ can trigger adenosine monophosphate–activated protein kinase activity, which is able to curtail inflammatory properties of mononuclear myeloid cells [50]. This indicates that high Ca2+ levels can exert anti-inflammatory MΦ activity, implying that, conversely, lowering Ca2+ might lead to increased proinflammatory activity. Following this reasoning, we show that lowering [Ca2+]i via NCX1 is linked to HS-boosted proinflammatory activation and antimicrobial MΦ function.

Moreover, low intracellular Ca2+ levels can induce autophagy (reviewed in [51]) where autophagy is regulated by numerous ion channels, exchangers, and transporters (reviewed in [52]). Previously, we found that the activation of autophagy represents an important auxiliary mechanism to boost antibacterial defense under HS conditions [10]. Here, we demonstrate that NCX1 plays an important role in this HS-boosted autophagy. Building on our earlier publication [10], our finding that interfering with NCX1 abolishes HS-increased autolysosomal formation provides a link between antibacterial responses and NCX1-dependent ion sensing. Our data show that extracellular Na+ is able to impact on intracellular organelle formation via NCX1. Very recently, it turned out that subcellular distribution of Na+ via two-pore channels plays an important role in controlling the volume of macropinosomes and, thereby, the cell size of MΦs [53]. Determining how increases in extracellular Na+ influence these subcellular processes requires further studies.

It is tempting to speculate that sensing of the ionic microenvironment represents a very ancient mechanism that allows animals to sense barrier dysfunction and consequently amplify antimicrobial and inflammatory MΦ responses. Here, we show that Na+ sensing by NCX1 represents an ionic mechanism important for MΦs to sense danger (Fig 10). The identification of this molecule opens new avenues to fine-tune MΦ immunobiology.

Go to:
Material and methods
Ethics statement
Animal care and use followed the regulations of the German Animal Welfare Act. Mice were housed at Zentrale Tierlaboratorien (ZTL) der Universität Regensburg and kept under conditions approved by Umweltamt der Stadt Regensburg.

Reagents and antibodies
The stimulations were performed with LPS from Sigma-Aldrich (E. coli O111:B4; #2630) and NaCl from Merck (#1.06400.1000). The channel inhibitors were purchased from Tocris (KB-R7943 mesylate [#12144] [17], SEA0400 [#6164] [18], amiloride [#0890] [54], EIPA [#3378] [55], and GSK 2193874 [#5106] [56]), Biotrend (tetrodotoxin [#BN0518] [57] and furosemide [(#BG0201] [58]), Sigma-Aldrich (DAPI [#D8417-5MG] [59]), and AppliChem (NiCl2 [#A2199,1000] [19]). For western blotting, we used rabbit anti-NCX1 antibodies from Abcam (#ab151608), rabbit anti-NFAT5 antibodies from Thermo Fisher Scientific (#PA1-023), and rabbit anti-ACTIN antibodies from Sigma-Aldrich (#A2066). Swine anti-rabbit HRP (Dako; #p0399) was used as secondary antibody.

MΦ generation
We euthanized the mice before getting the marrow. BMDMs were generated in Teflon bags or Petri dishes supplemented with supernatant of L929 cells, as described earlier [60].

RNAi in MΦ
Prior to the experiments, we confirmed that commercially available siRNA binds to the predicted Slc8a1 transcript XM_006523944 using BLAST. We performed RNAi using Slc8a1 siRNA (Dharmacon; # L-044925-00-0005) as described earlier [61]. After electroporation, cells were incubated for 1 d before further treatment and analysis.

MΦ stimulation and infection experiments
MΦs were stimulated with LPS, resulting in a final concentration of 10 ng/ml LPS. NaCl (40 mM) or urea (80 mM) was added to MΦs where indicated. Both an increase of 40 mM in NaCl or adding of 80 mM urea increase osmolality by 80 mOsm/kg [1]. MΦ infection experiments were performed as described previously [1,10]. In brief, BMDMs or RAW264.7 MΦs were infected with E. coli HB101 (multiplicity of infection [MOI] of 100) for 1 h ± HS or SEA0400 (25 μM). MΦs were washed two times with PBS in order to remove remaining extracellular bacteria. Gentamicin (100 μg/ml) was added to the NS and HS conditions for an additional 1 h. Subsequently, cells were lysed with 0.1% Triton/0.05% Tween-20 in PBS. Bacterial solutions were serially diluted and plated on Müller–Hinton agar plates. The next day, colony forming units (CFUs) were manually counted and normalized to the mean of the untreated NS group.

Measurement of intracellular Na+ by atomic absorption spectrometry
In all, 2 × 106 RAW264.7 MΦs were stimulated with LPS ± HS for 10 min. Subsequently, cells were harvested and washed with iso-osmolal urea buffer. The MΦ pellet was lysed in 100 μl H2Odd containing 0.1% Triton X, and the Na+ content was determined by atomic absorption spectrometry (Perkin Elmer, model 3100).

Intracellular ion determination via epifluorescence microscopy
MΦs were seeded on FluoroDish plates. For Na+ and Ca2+ measurements, cells were stained as indicated with SBFI (Thermo Fisher Scientific; #S1264) or Fura-2 (Thermo Fisher Scientific; #F1221) in Tyrode solution (140 mM NaCl, 4 mM KCl, 1 mM MgCl2, 5 mM HEPES, 1 mM CaCl2, 10 mM glucose) containing 0.04% Pluronic (Sigma; #P2443). Cells were subjected to ratiometric quantification of the respective fluophor via live cell imaging for 5–10 min (epifluorescence microscope Motic model 410E). After 10 sec, 40 mM NaCl ± LPS was added to the dish, or cells were left untreated. Fluorescence emissions were recorded, analyzed using IonWizard (IonOptix Cooperation) as described earlier [62], and normalized to the start value.

Intracellular Ca2+ measurements using flow cytometry
RAW264.7 MΦs were stained with the Ca2+-sensitive dyes Fluo-3 (Thermo Fisher Scientific; #F-1241) and Fura-Red (Thermo Fisher Scientific; #F-3021) [63] for 20 min at room temperature in Tyrode solution containing Pluronic. Subsequently, cells were washed and transferred into FACS tubes. Mean fluorescence intensities of Fluo-3 and Fura-Red were recorded over time using flow cytometry (FACSCanto II). After a lead-in phase of 2 min, HS ± LPS was added, or cells were left untreated. Samples were measured for an additional 5 min. Finally, Tg (Tocris; #1138) was added, and measurements were continued for 3 min. Recordings were analyzed via the “kinetics” tool of FlowJo (version 10). Fluo-3/Fura-Red ratios were calculated and normalized to the mean of the last three recordings before stimulation.

Whole-cell patch clamp experiments
For electrophysiological measurements, BMDMs were used, and medium was replaced by an extracellular bathing solution (EC) containing 140 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, and 10 mM glucose (pH 7.35) and kept at room temperature. The dishes were placed on the stage of an inverted microscope. Patch pipettes were pulled from filamented borosilicate glass capillaries showing resistances of 2–4.5 MΩ when filled with intracellular pipette solution (IC) containing 140 mM K-gluconate, 5 mM NaCl, 2 mM MgCl2, 1 mM CaCl2, 11 mM EGTA, 10 mM HEPES, 2 mM Mg-ATP, and 0.3 mM Na-GTP (pH 7.35). The whole-cell configuration of the patch clamp technique [64] was used to record membrane currents and potential in voltage-clamp or current-clamp mode. Signals were recorded and digitized with an Axopatch 200B amplifier (Axon Instruments, Union City, CA) with a Digidata 1200 converter (Axon Instruments) or an EPC10 amplifier (HEKA Elektronik, Lambrecht/Pfalz, Germany). Analysis was performed using the software pCLAMP 10.2 (Axon Instruments) or PATCHMASTER 2x90 (HEKA).

Voltage steps were applied from a holding potential (−80 mV or −20 mV) from −100 mV to +80 mV in 10-mV increments and held for 200 ms. The voltage step protocol was performed 2 min after attaining the whole-cell configuration; afterward, cells were stimulated with 40 mM NaCl, 10 ng/ml LPS, or 5 mM NiCl2. At 3 min after stimulation, another voltage-clamp protocol was performed.

In a subset of experiments, a voltage ramp protocol from approximately −80 mV to approximately +80 mV (holding potential −20 mV, duration 4 sec, 40 mV/sec) was applied. Measured currents were normalized to the membrane capacitance. For Vm recordings, the cells were measured over 4 min in current-clamp-zero mode. After 50 sec, cells were stimulated. The first and last 50 sec of this recording were averaged to yield the Vm before and after stimulation.

For voltages between −40 mV and 30 mV, we fitted a straight line through the Ni-sensitive current data of LPS- and LPS + HS–treated MΦs using the nonlinear regression tool provided by GraphPad PRISM (version 6.0). We used the YIntercept and slope to determine ErevNCX.

Autophagy characterization
We seeded RFP-GFP-mLC3 RAW264.7 MΦs (obtained from Invivogen; rawdf-mlc3) on coverslips and infected them with MOI 100 of E. coli HB101 ± HS ± 30 min preincubation with SEA0400. At 1 h after infection, cells were washed twice with PBS and incubated in NS or HS media containing 100 μg/ml gentamicin. At 2 h after infection, cells were washed, fixed in 4% paraformaldehyde for 20 min at room temperature, and mounted with ProLong Gold (containing DAPI). A Leica TCS SP5 confocal laser microscope was used for imaging. Images were processed using the Leica Application Suite (version 2.7.3.9723) and Microsoft PowerPoint.

Bioinformatic analysis of Slc8a1 isoform expression
RNA of three murine BMDM samples differentiated in vitro for 8 d using M-CSF were isolated with Trizol and the miRNeasy micro kit (Qiagen) according to the manufacturer’s protocol. The quality of the RNA was assessed by visualization of 28S and 18S band integrity on a Tapestation 2200 (Agilent). In all, 100 ng of RNA was converted into cDNA libraries using the TruSeq RNA library preparation kit version 2. Size distribution of cDNA libraries was measured using the Agilent High Sensitivity DNA assay on a Tapestation 2200 (Agilent). cDNA libraries were quantified using KAPA Library Quantification Kits (Kapa Biosystems). After cluster generation on a cBot, 75-bp single-read sequencing was performed on a HiSeq1500.

For alignment and genome-guided transcriptome assembly, we followed the “new tuxedo” protocol [65]. After base calling and demultiplexing using CASAVA version 1.8.2, the 75-bp single-end reads were aligned to the mouse reference genome mm10 using HISAT2 version 2.0.6 with option–dta and sorted and indexed using Samtools version 0.1.19. Subsequently, transcriptome assembly was performed using StringTie version 1.3.2d, with default parameters for each of the three samples guided by GENCODE vM10 transcriptome annotation. Merging the individual assemblies using the StringTie–merge option produced two novel multiexon transcript variants for Slc8a1, labeled StringTie Assembly version 1 and version 2 (Fig 3B). Transcript abundances were estimated by rerunning StringTie with options -B -e and analyzed using the R package Ballgown [66]. The RNA-seq data were uploaded in the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov) under accession number GSE136662.

Quantification of nitrite and lactate dehydrogenase activity
Griess assays were used to quantify nitrite levels in the supernatants as described earlier [1,10]. The cell cytotoxicity kit (Roche; #11644793001) was used to measure lactate dehydrogenase (LDH) activities in supernatants and cell pellets. To assess the relative LDH release, the supernatant-to-pellet ratio of LDH activity was calculated.

Immunoblotting
For analysis of NFAT5 and ACTIN, MΦs were lysed in 8 M urea containing a protease inhibitor cocktail (Roche; #11836170001), and immunoblotting was performed as described earlier [1,10]. For analysis of NCX1, membranes of MΦs were isolated using the Mem-PER Plus Kit (Thermo Fisher Scientific; #89842Y) according to the manufacturer’s instructions, and immunoblotting for NCX1 was performed. Images were acquired on an Intas Chemostar chemoluminescence imager and processed using Adobe Photoshop CS6 and Microsoft PowerPoint. We used ImageJ (version 1.50b; Rasband, W. S., ImageJ, United States National Institutes of Health, ImageJ) for densitometry of western blots.

RNA isolation, reverse transcriptions, real-time PCR, and relative quantification
RNA isolation and qRT-PCR of cDNA was performed as described previously [10]. We obtained the following probes from Thermo Fisher Scientific for the analyses: Slc8a1 (Mm01232254_m1), Slc8a2 (Mm00455836_m1), Slc8a3 (Mm01309304_m1), Nos2 (Mm00440485_m1), and Hprt (Mm00446968_m1). Relative expression levels were determined using the ΔΔCT method. Hprt served as endogenous control.

Statistical analysis
All graphs were generated using GraphPad PRISM (version 6.0). Data sets were assessed for normality distribution via Kolomogorov–Smirnov tests. Normally distributed data were compared by unpaired, two-tailed Student t test (for two groups). We compared non-normally distributed data sets using Mann–Whitney tests (for two groups). In case of paired experiments (densitometry), we analyzed the data using paired Student t tests. Unless indicated otherwise, all data are depicted as means ± SD or 95% CI. We considered p-values < 0.05 as statistically significant.

Go to:
Supporting information
S1 Table
Inhibitor data.
List of used inhibitors and concentrations.

(DOCX)

Click here for additional data file.(13K, docx)
S1 Fig
Effects of NCX inhibitors on NO production.
NO production was quantified 24 h after incubation of RAW264.7 MΦs ± HS ± after pretreatment with indicated inhibitor. (A) Inhibitor KB-R (n = 9). (B) Inhibitor NiCl2 (n = 6). (C) Inhibitor SEA (n = 6). For numerical raw data, please see S1 Data. HS, high salt; MΦ, monocyte/macrophage-like cell; KB-R, KB-R7943 mesylate; NCX, Na+/Ca2+ exchanger; NO, nitric oxide; SEA, SEA 0400.

(TIF)

Click here for additional data file.(1.3M, tif)
S2 Fig
Current clamp measurements of MΦ upon LPS stimulation.
Vm of BMDMs before and after addition of 10 ng/ml LPS (n = 8; paired t test; *p < 0.05). For numerical raw data, please see S1 Data. BMDM, bone marrow–derived MΦ; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; Vm, membrane potential.

(TIF)

Click here for additional data file.(1.1M, tif)
S3 Fig
Effects on selected NCX inhibitors on MΦ viability.
RAW264.7 MΦs were pretreated with indicated NCX inhibitors. At 4 h after stimulation ± LPS ± HS relative LDH release normalized to total cellular LDH content was assessed. Exposure of cells to 0.1% Triton X was used as positive control for cytotoxicity (means ± SD; n = 9). For numerical raw data, please see S1 Data. HS, high salt; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; NCX, Na+/Ca2+ exchanger.

(TIF)

Click here for additional data file.(1.4M, tif)
S4 Fig
Effects of NCX inhibitors on NFAT5 accumulation.
(A) NFAT5 levels 6 h after incubation of RAW264.7 MΦs ± HS ± KB-R pretreatment. Immunoblotting and densitometry (n = 4; paired t tests; *p < 0.05). (B) NFAT5 levels 4 h after incubation of RAW264.7 MΦs ± HS ± NiCl2 pretreatment. Immunoblotting and densitometry (n = 4; paired t tests; *p < 0.05). (C) As in (B), but SEA was used to inhibit NCX (n = 7; paired t tests; *p < 0.05). For numerical raw data, please see S1 Data. For raw immunoblots, please see S1 Blots. HS, high salt; KB-R, KB-R7943 mesylate; MΦ, monocyte/macrophage-like cell; NCX, Na+/Ca2+ exchanger; NFAT5, nuclear factor of activated T cells 5; SEA, SEA 0400.

(TIF)

Click here for additional data file.(1.7M, tif)
S5 Fig
Slc8a1 silencing reduces Slc8a1 mRNA levels.
Slc8a1 expression in ns or Slc8a1-specific siRNA–treated BMDMs (means ± SD; n = 8; Student t test; *p < 0.05). For numerical raw data, please see S1 Data. BMDM, bone marrow–derived MΦ; ns, nonsilencing; siRNA, small interfering RNA; Slc8, solute carrier family 8.

(TIF)

Click here for additional data file.(1.1M, tif)
S6 Fig
Slc8a1 silencing diminishes inward currents upon HS treatment.
Current/voltage relationships of BMDMs treated with ns siRNA and Slc8a1 siRNA. These MΦ were stimulated with HS followed by NiCl2 treatment. Whole-cell VR experiments were performed, and Ni-sensitive (i.e., NCX-sensitive) currents were determined (means ± 95% CI; n = 9–10). For numerical raw data, please see S1 Data. BMDM, bone marrow–derived MΦ; HS, high salt; MΦ, monocyte/macrophage-like cell; NCX, Na+/Ca2+ exchanger; ns, nonsilencing; siRNA, small interfering RNA; Slc8, solute carrier family 8; VR, voltage ramp.

(TIF)

Click here for additional data file.(1.4M, tif)
S7 Fig
Slc8a1 silencing reduces HS-augmented NFAT5 accumulation.
(A) NFAT5 expression 4 h after LPS ± HS in ns siRNA and Slc8a1 siRNA–treated RAW264.7 MΦs. Representative NFAT5 and ACTIN immunoblot out of two similar experiments. (B) As in (A), but HS-triggered Δ nitrite after 24 h (n = 3). For numerical raw data, please see S1 Data. For raw immunoblots, please see S1 Blots. HS, high salt; LPS, lipopolysaccharide; MΦ, monocyte/macrophage-like cell; NFAT5, nuclear factor of activated T cells 5; ns, nonsilencing; siRNA, small interfering RNA; Slc8, solute carrier family 8.

(TIF)

Click here for additional data file.(1.3M, tif)
S1 Data
Numerical raw data.
All numerical raw data are combined in a single Excel file “S1_Data.xlsx”. This file consists of several spreadsheets. Each spreadsheet contains the raw data of one subfigure.

(XLSX)

Click here for additional data file.(436K, xlsx)
S1 Blots
Raw images.
The file “S1_Blots.pdf” covers all uncropped western blot images, including size standards and descriptions.

(PDF)

Click here for additional data file.(3.4M, pdf)
Go to:
Acknowledgments
We are grateful to Monika Nowottny, Christine Lindner, Barbara Bodendorfer, and Dr. Roland Lang for help in generating macrophages.

Go to:
Abbreviations
BMDM bone marrow–derived MΦ
[Ca2+]i intracellular Ca2+ in situ
Erev reversal potential
GFP green fluorescent protein
HS high salt
KB-R KB-R7943 mesylate
LPS lipopolysaccharide
MΦ monocyte/macrophage-like cell
mLC3 microtubule-associated protein 1 light chain 3
[Na+]i intracellular Na+ in situ
NCBI National Center for Biotechnology Information
NCX Na+/Ca2+ exchanger
NFAT5 nuclear factor of activated T cells 5
NO nitric oxide
NS normal salt
ns nonsilencing
NOS2 nitric oxide synthase 2
ORF open reading frame
qRT-PCR quantitative real-time PCR
RFP red fluorescent protein
RNAi RNA interference
RNA-seq RNA sequencing
ROS reactive oxygen species
SBFI sodium-binding benzofuran isophthalate
SEA SEA 0400
siRNA small interfering RNA
SLC8 solute carrier family 8
Tg thapsigargin
TRPV4 transient receptor potential cation channel subfamily V member 4
UTR untranslated region
Vm membrane potential.
Go to:
Funding Statement
JJ received funding from the DFG (JA1993/6-1) and DFG SFB 1350 grant (project nr. 387509280, TPB5). SW is funded by DFG grants WA 2539/4-1, 5-1, and 7-1, by a DFG SFB 1350 grant (project nr. 387509280, TPA6), and by the Deutsches Zentrum für Herz-Kreislauf-Forschung ([DZHK]; German Center for Cardiovascular Research). JJ, SW, and KH are supported by the ReForM C program of the Medical Faculty University of Regensburg. JLS received funding from the DFG under Germany’s Excellence Strategy – EXC2151 – 390873048 and the EU under project SYSCID (grant nr. 733100). DNM is supported by the DZHK and the DFG (SFB 1365). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Go to:
Data Availability
All relevant data are within the paper and its supporting information files (S1 Data, S1 Blots). The RNA-seq data was deposited in the Gene Expression Omnibus (GEO) database (National Center for Biotechnology Information). The accession number is GSE136662.

Go to:
References
1. Jantsch J, Schatz V, Friedrich D, Schroder A, Kopp C, Siegert I, et al. Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense. Cell Metab. 2015;21(3):493–501. Epub 2015/03/05. 10.1016/j.cmet.2015.02.003 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
2. Matthias J, Maul J, Noster R, Meinl H, Chao YY, Gerstenberg H, et al. Sodium chloride is an ionic checkpoint for human TH2 cells and shapes the atopic skin microenvironment. Sci Transl Med. 2019;11(480). Epub 2019/02/23. 10.1126/scitranslmed.aau0683 . [PubMed] [CrossRef] [Google Scholar]
3. Schwartz L, Guais A, Pooya M, Abolhassani M. Is inflammation a consequence of extracellular hyperosmolarity? J Inflamm (Lond). 2009;6:21 Epub 2009/06/25. 10.1186/1476-9255-6-21 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
4. Machnik A, Neuhofer W, Jantsch J, Dahlmann A, Tammela T, Machura K, et al. Macrophages regulate salt-dependent volume and blood pressure by a vascular endothelial growth factor-C-dependent buffering mechanism. Nat Med. 2009;15(5):545–52. Epub 2009/05/05. 10.1038/nm.1960 . [PubMed] [CrossRef] [Google Scholar]
5. Machnik A, Dahlmann A, Kopp C, Goss J, Wagner H, van Rooijen N, et al. Mononuclear phagocyte system depletion blocks interstitial tonicity-responsive enhancer binding protein/vascular endothelial growth factor C expression and induces salt-sensitive hypertension in rats. Hypertension. 2010;55(3):755–61. Epub 2010/02/10. 10.1161/HYPERTENSIONAHA.109.143339 . [PubMed] [CrossRef] [Google Scholar]
6. Wiig H, Schroder A, Neuhofer W, Jantsch J, Kopp C, Karlsen TV, et al. Immune cells control skin lymphatic electrolyte homeostasis and blood pressure. J Clin Invest. 2013;123(7):2803–15. Epub 2013/06/01. 10.1172/JCI60113 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
7. Aramburu J, Lopez-Rodriguez C. Regulation of Inflammatory Functions of Macrophages and T Lymphocytes by NFAT5. Front Immunol. 2019;10:535 Epub 2019/04/06. 10.3389/fimmu.2019.00535 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
8. Choi SY, Lee-Kwon W, Kwon HM. The evolving role of TonEBP as an immunometabolic stress protein. Nat Rev Nephrol. 2020. 10.1038/s41581-020-0261-1 . [PubMed] [CrossRef] [Google Scholar]
9. Berry MR, Mathews RJ, Ferdinand JR, Jing C, Loudon KW, Wlodek E, et al. Renal Sodium Gradient Orchestrates a Dynamic Antibacterial Defense Zone. Cell. 2017;170(5):860–74 e19. Epub 2017/08/15. 10.1016/j.cell.2017.07.022 . [PubMed] [CrossRef] [Google Scholar]
10. Neubert P, Weichselbaum A, Reitinger C, Schatz V, Schroder A, Ferdinand JR, et al. HIF1A and NFAT5 coordinate Na(+)-boosted antibacterial defense via enhanced autophagy and autolysosomal targeting. Autophagy. 2019:1–18. Epub 2019/04/16. 10.1080/15548627.2019.1596483 . [PMC free article] [PubMed] [CrossRef] [Google Scholar]
11. Binger KJ, Gebhardt M, Heinig M, Rintisch C, Schroeder A, Neuhofer W, et al. High salt reduces the activation of IL-4- and IL-13-stimulated macrophages. J Clin Invest. 2015;125(11):4223–38. Epub 2015/10/21. 10.1172/JCI80919 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
12. Ip WK, Medzhitov R. Macrophages monitor tissue osmolarity and induce inflammatory response through NLRP3 and NLRC4 inflammasome activation. Nat Commun. 2015;6:6931 Epub 2015/05/12. 10.1038/ncomms7931 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
13. Zhang WC, Zheng XJ, Du LJ, Sun JY, Shen ZX, Shi C, et al. High salt primes a specific activation state of macrophages, M(Na). Cell Res. 2015;25(8):893–910. Epub 2015/07/25. 10.1038/cr.2015.87 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
14. Zhang WC, Du LJ, Zheng XJ, Chen XQ, Shi C, Chen BY, et al. Elevated sodium chloride drives type I interferon signaling in macrophages and increases antiviral resistance. J Biol Chem. 2018;293(3):1030–9. Epub 2017/12/06. 10.1074/jbc.M117.805093 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
15. Hucke S, Eschborn M, Liebmann M, Herold M, Freise N, Engbers A, et al. Sodium chloride promotes pro-inflammatory macrophage polarization thereby aggravating CNS autoimmunity. J Autoimmun. 2016;67:90–101. Epub 2015/11/21. 10.1016/j.jaut.2015.11.001 . [PubMed] [CrossRef] [Google Scholar]
16. Heng TS, Painter MW. The Immunological Genome Project: networks of gene expression in immune cells. Nature immunology. 2008;9(10):1091–4. Epub 2008/09/19. 10.1038/ni1008-1091 . [PubMed] [CrossRef] [Google Scholar]
17. Iwamoto T, Watano T, Shigekawa M. A Novel Isothiourea Derivative Selectively Inhibits the Reverse Mode of Na+/Ca2+ Exchange in Cells Expressing NCX1. Journal of Biological Chemistry. 1996;271(37):22391–7. 10.1074/jbc.271.37.22391 [PubMed] [CrossRef] [Google Scholar]
18. Matsuda T, Arakawa N, Takuma K, Kishida Y, Kawasaki Y, Sakaue M, et al. SEA0400, a Novel and Selective Inhibitor of the Na+-Ca2+ Exchanger, Attenuates Reperfusion Injury in the in Vitro and in Vivo Cerebral Ischemic Models. Journal of Pharmacology and Experimental Therapeutics. 2001;298(1):249–56. [PubMed] [Google Scholar]
19. Kimura J, Miyamae S, Noma A. Identification of sodium-calcium exchange current in single ventricular cells of guinea-pig. J Physiol. 1987;384:199–222. 10.1113/jphysiol.1987.sp016450 . [PMC free article] [PubMed] [CrossRef] [Google Scholar]
20. Donnadieu E, Trautmann A. Is there a Na+/Ca2+ exchanger in macrophages and in lymphocytes? Pflugers Arch. 1993;424(5–6):448–55. Epub 1993/09/01. 10.1007/BF00374907 . [PubMed] [CrossRef] [Google Scholar]
21. Staiano RI, Granata F, Secondo A, Petraroli A, Loffredo S, Frattini A, et al. Expression and function of Na+/Ca2+ exchangers 1 and 3 in human macrophages and monocytes. Eur J Immunol. 2009;39(5):1405–18. Epub 2009/04/08. 10.1002/eji.200838792 . [PubMed] [CrossRef] [Google Scholar]
22. Blaustein MP, Lederer WJ. Sodium/calcium exchange: its physiological implications. Physiol Rev. 1999;79(3):763–854. Epub 1999/07/03. 10.1152/physrev.1999.79.3.763 . [PubMed] [CrossRef] [Google Scholar]
23. Gerth A, Grosche J, Nieber K, Hauschildt S. Intracellular LPS inhibits the activity of potassium channels and fails to activate NFkappaB in human macrophages. J Cell Physiol. 2005;202(2):442–52. Epub 2004/09/25. 10.1002/jcp.20146 . [PubMed] [CrossRef] [Google Scholar]
24. Ypey DL, Clapham DE. Development of a delayed outward-rectifying K+ conductance in cultured mouse peritoneal macrophages. Proc Natl Acad Sci U S A. 1984;81(10):3083–7. Epub 1984/05/01. 10.1073/pnas.81.10.3083 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
25. Baartscheer A, Schumacher CA, Coronel R, Fiolet JW. The Driving Force of the Na/Ca-Exchanger during Metabolic Inhibition. Front Physiol. 2011;2:10 10.3389/fphys.2011.00010 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
26. Young JD, Unkeless JC, Kaback HR, Cohn ZA. Macrophage membrane potential changes associated with gamma 2b/gamma 1 Fc receptor-ligand binding. Proc Natl Acad Sci U S A. 1983;80(5):1357–61. Epub 1983/03/01. 10.1073/pnas.80.5.1357 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
27. Gallin EK, Gallin JI. Interaction of chemotactic factors with human macrophages. Induction of transmembrane potential changes. J Cell Biol. 1977;75(1):277–89. Epub 1977/10/01. 10.1083/jcb.75.1.277 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
28. Gallin EK, Livengood DR. Nonlinear current-voltage relationships in cultured macrophages. J Cell Biol. 1980;85(1):160–5. Epub 1980/04/01. 10.1083/jcb.85.1.160 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
29. Hanley PJ, Musset B, Renigunta V, Limberg SH, Dalpke AH, Sus R, et al. Extracellular ATP induces oscillations of intracellular Ca2+ and membrane potential and promotes transcription of IL-6 in macrophages. Proc Natl Acad Sci U S A. 2004;101(25):9479–84. Epub 2004/06/15. 10.1073/pnas.0400733101 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
30. Hulsmans M, Clauss S, Xiao L, Aguirre AD, King KR, Hanley A, et al. Macrophages Facilitate Electrical Conduction in the Heart. Cell. 2017;169(3):510–22 e20. Epub 2017/04/22. 10.1016/j.cell.2017.03.050 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
31. Philipson KD, Nicoll DA. Sodium-calcium exchange: a molecular perspective. Annu Rev Physiol. 2000;62:111–33. Epub 2000/06/09. 10.1146/annurev.physiol.62.1.111 . [PubMed] [CrossRef] [Google Scholar]
32. Masek KS, Fiore J, Leitges M, Yan SF, Freedman BD, Hunter CA. Host cell Ca2+ and protein kinase C regulate innate recognition of Toxoplasma gondii. J Cell Sci. 2006;119(Pt 21):4565–73. Epub 2006/11/01. 10.1242/jcs.03206 . [PubMed] [CrossRef] [Google Scholar]
33. Shinomiya H, Nakano M. Calcium ionophore A23187 does not stimulate lipopolysaccharide nonresponsive C3H/HeJ peritoneal macrophages to produce interleukin 1. J Immunol. 1987;139(8):2730–6. Epub 1987/10/15. PubMed . [PubMed] [Google Scholar]
34. Vaeth M, Zee I, Concepcion AR, Maus M, Shaw P, Portal-Celhay C, et al. Ca2+ Signaling but Not Store-Operated Ca2+ Entry Is Required for the Function of Macrophages and Dendritic Cells. J Immunol. 2015;195(3):1202–17. 10.4049/jimmunol.1403013 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
35. Treiman M, Caspersen C, Christensen SB. A tool coming of age: thapsigargin as an inhibitor of sarco-endoplasmic reticulum Ca(2+)-ATPases. Trends Pharmacol Sci. 1998;19(4):131–5. 10.1016/s0165-6147(98)01184-5 . [PubMed] [CrossRef] [Google Scholar]
36. Amran MS, Homma N, Hashimoto K. Pharmacology of KB-R7943: a Na+-Ca2+ exchange inhibitor. Cardiovasc Drug Rev. 2003;21(4):255–76. Epub 2003/12/04. 10.1111/j.1527-3466.2003.tb00121.x . [PubMed] [CrossRef] [Google Scholar]
37. Kimura S, Noda T, Yoshimori T. Dissection of the Autophagosome Maturation Process by a Novel Reporter Protein, Tandem Fluorescent-Tagged LC3. Autophagy. 2007;3(5):452–60. 10.4161/auto.4451 [PubMed] [CrossRef] [Google Scholar]
38. Muller DN, Wilck N, Haase S, Kleinewietfeld M, Linker RA. Sodium in the microenvironment regulates immune responses and tissue homeostasis. Nat Rev Immunol. 2019;19(4):243–54. Epub 2019/01/16. 10.1038/s41577-018-0113-4 . [PubMed] [CrossRef] [Google Scholar]
39. Schatz V, Neubert P, Schroder A, Binger K, Gebhard M, Muller DN, et al. Elementary immunology: Na(+) as a regulator of immunity. Pediatr Nephrol. 2017;32(2):201–10. Epub 2016/02/28. 10.1007/s00467-016-3349-x [PMC free article] [PubMed] [CrossRef] [Google Scholar]
40. Gurusamy D, Clever D, Eil R, Restifo NP. Novel "Elements" of Immune Suppression within the Tumor Microenvironment. Cancer Immunol Res. 2017;5(6):426–33. 10.1158/2326-6066.CIR-17-0117 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
41. Han J, Lee JD, Bibbs L, Ulevitch RJ. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science. 1994;265(5173):808–11. Epub 1994/08/05. 10.1126/science.7914033 . [PubMed] [CrossRef] [Google Scholar]
42. Lopez-Rodriguez C, Aramburu J, Rakeman AS, Rao A. NFAT5, a constitutively nuclear NFAT protein that does not cooperate with Fos and Jun. Proc Natl Acad Sci U S A. 1999;96(13):7214–9. Epub 1999/06/23. 10.1073/pnas.96.13.7214 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
43. Miyakawa H, Woo SK, Dahl SC, Handler JS, Kwon HM. Tonicity-responsive enhancer binding protein, a rel-like protein that stimulates transcription in response to hypertonicity. Proceedings of the National Academy of Sciences of the United States of America. 1999;96(5):2538–42. 10.1073/pnas.96.5.2538 . [PMC free article] [PubMed] [CrossRef] [Google Scholar]
44. Ko BCB, Turck CW, Lee KWY, Yang Y, Chung SSM. Purification, Identification, and Characterization of an Osmotic Response Element Binding Protein. Biochemical and Biophysical Research Communications. 2000;270(1):52–61. 10.1006/bbrc.2000.2376 [PubMed] [CrossRef] [Google Scholar]
45. West AP, Brodsky IE, Rahner C, Woo DK, Erdjument-Bromage H, Tempst P, et al. TLR signalling augments macrophage bactericidal activity through mitochondrial ROS. Nature. 2011;472(7344):476–80. Epub 2011/04/29. 10.1038/nature09973 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
46. Black JA, Waxman SG. Noncanonical roles of voltage-gated sodium channels. Neuron. 2013;80(2):280–91. Epub 2013/10/22. 10.1016/j.neuron.2013.09.012 . [PubMed] [CrossRef] [Google Scholar]
47. Barbaro NR, Foss JD, Kryshtal DO, Tsyba N, Kumaresan S, Xiao L, et al. Dendritic Cell Amiloride-Sensitive Channels Mediate Sodium-Induced Inflammation and Hypertension. Cell Rep. 2017;21(4):1009–20. Epub 2017/10/27. 10.1016/j.celrep.2017.10.002 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
48. Cahalan MD, Chandy KG. The functional network of ion channels in T lymphocytes. Immunol Rev. 2009;231(1):59–87. Epub 2009/09/17. 10.1111/j.1600-065X.2009.00816.x [PMC free article] [PubMed] [CrossRef] [Google Scholar]
49. Westphalen K, Gusarova GA, Islam MN, Subramanian M, Cohen TS, Prince AS, et al. Sessile alveolar macrophages communicate with alveolar epithelium to modulate immunity. Nature. 2014;506(7489):503–6. Epub 2014/01/28. 10.1038/nature12902 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
50. Nurbaeva MK, Schmid E, Szteyn K, Yang W, Viollet B, Shumilina E, et al. Enhanced Ca(2)(+) entry and Na+/Ca(2)(+) exchanger activity in dendritic cells from AMP-activated protein kinase-deficient mice. FASEB J. 2012;26(7):3049–58. 10.1096/fj.12-204024 . [PubMed] [CrossRef] [Google Scholar]
51. Decuypere JP, Bultynck G, Parys JB. A dual role for Ca(2+) in autophagy regulation. Cell Calcium. 2011;50(3):242–50. Epub 2011/05/17. 10.1016/j.ceca.2011.04.001 . [PubMed] [CrossRef] [Google Scholar]
52. Kondratskyi A, Kondratska K, Skryma R, Klionsky DJ, Prevarskaya N. Ion channels in the regulation of autophagy. Autophagy. 2018;14(1):3–21. Epub 2017/10/06. 10.1080/15548627.2017.1384887 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
53. Freeman SA, Uderhardt S, Saric A, Collins RF, Buckley CM, Mylvaganam S, et al. Lipid-gated monovalent ion fluxes regulate endocytic traffic and support immune surveillance. Science. 2020;367(6475):301–5. 10.1126/science.aaw9544 . [PubMed] [CrossRef] [Google Scholar]
54. Bentley PJ. Amiloride: a potent inhibitor of sodium transport across the toad bladder. J Physiol. 1968;195(2):317–30. 10.1113/jphysiol.1968.sp008460 . [PMC free article] [PubMed] [CrossRef] [Google Scholar]
55. Vigne P, Frelin C, Cragoe EJ, Lazdunski M. Structure-activity relationships of amiloride and certain of its analogues in relation to the blockade of the Na+/H+ exchange system. Molecular Pharmacology. 1984;25(1):131–6. [PubMed] [Google Scholar]
56. Thorneloe KS, Cheung M, Bao W, Alsaid H, Lenhard S, Jian M-Y, et al. An Orally Active TRPV4 Channel Blocker Prevents and Resolves Pulmonary Edema Induced by Heart Failure. Science Translational Medicine. 2012;4(159):159ra48–ra48. 10.1126/scitranslmed.3004276 [PubMed] [CrossRef] [Google Scholar]
57. Takata M, Moore JW, Kao CY, Fuhrman FA. Blockage of sodium conductance increase in lobster giant axon by tarichatoxin (tetrodotoxin). J Gen Physiol. 1966;49(5):977–88. 10.1085/jgp.49.5.977 . [PMC free article] [PubMed] [CrossRef] [Google Scholar]
58. Hoffman JF, Kregenow FM. The Characterization of New Energy Dependent Cation Transport Processes in Red Blood Cells. Annals of the New York Academy of Sciences. 1966;137(2):566–76. 10.1111/j.1749-6632.1966.tb50182.x [PubMed] [CrossRef] [Google Scholar]
59. Chen X, Qiu L, Li M, Dürrnagel S, Orser BA, Xiong Z-G, et al. Diarylamidines: high potency inhibitors of acid-sensing ion channels. Neuropharmacology. 2010;58(7):1045–53. Epub 2010/01/28. 10.1016/j.neuropharm.2010.01.011 . [PMC free article] [PubMed] [CrossRef] [Google Scholar]
60. Schleicher U, Bogdan C. Generation, culture and flow-cytometric characterization of primary mouse macrophages. Methods Mol Biol. 2009;531:203–24. Epub 2009/04/07. 10.1007/978-1-59745-396-7_14 . [PubMed] [CrossRef] [Google Scholar]
61. Siegert I, Schatz V, Prechtel AT, Steinkasserer A, Bogdan C, Jantsch J. Electroporation of siRNA into Mouse Bone Marrow-Derived Macrophages and Dendritic Cells In: Li S, Cutrera J, Heller R, Teissie J, editors. Electroporation Protocols: Preclinical and Clinical Gene Medicine. New York, NY: Springer New York; 2014. p. 111–9. [Google Scholar]
62. Mustroph J, Wagemann O, Lücht CM, Trum M, Hammer KP, Sag CM, et al. Empagliflozin reduces Ca/calmodulin-dependent kinase II activity in isolated ventricular cardiomyocytes. ESC heart failure. 2018;5(4):642–8. 10.1002/ehf2.12336 . [PMC free article] [PubMed] [CrossRef] [Google Scholar]
63. June CH, Abe R, Rabinovitch PS. Measurement of Intracellular Ions by Flow Cytometry. Current Protocols in Immunology. 1995;14(1):5–21. 10.1002/0471142735.im0505s14 [CrossRef] [Google Scholar]
64. Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 1981;391(2):85–100. Epub 1981/08/01. 10.1007/BF00656997 . [PubMed] [CrossRef] [Google Scholar]
65. Pertea M, Kim D, Pertea GM, Leek JT, Salzberg SL. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat Protoc. 2016;11(9):1650–67. Epub 2016/08/26. 10.1038/nprot.2016.095 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
66. Frazee AC, Pertea G, Jaffe AE, Langmead B, Salzberg SL, Leek JT. Ballgown bridges the gap between transcriptome assembly and expression analysis. Nat Biotechnol. 2015;33(3):243–6. Epub 2015/03/10. 10.1038/nbt.3172 [PMC free article] [PubMed] [CrossRef] [Google Scholar]

 

[Tristan Loscha]

-

 

[Tristan Loscha]

J Clin Invest. 2015 Nov 2; 125(11): 4223–4238.
Published online 2015 Oct 20. doi: 10.1172/JCI80919
PMCID: PMC4639967
PMID: 26485286
High salt reduces the activation of IL-4– and IL-13–stimulated macrophages
Katrina J. Binger,1,2 Matthias Gebhardt,1,2 Matthias Heinig,2 Carola Rintisch,2 Agnes Schroeder,3 Wolfgang Neuhofer,4 Karl Hilgers,3 Arndt Manzel,3 Christian Schwartz,3 Markus Kleinewietfeld,5,6 Jakob Voelkl,7 Valentin Schatz,8 Ralf A. Linker,3 Florian Lang,7 David Voehringer,3 Mark D. Wright,9 Norbert Hubner,2 Ralf Dechend,1,10 Jonathan Jantsch,8 Jens Titze,3,11 and Dominik N. Müller1,2,12
Author information Article notes Copyright and License information Disclaimer
See commentary "Over-salting ruins the balance of the immune menu" on page 4002.
This article has been cited by other articles in PMC.
Associated Data
Supplementary Materials
Go to:
Abstract
A high intake of dietary salt (NaCl) has been implicated in the development of hypertension, chronic inflammation, and autoimmune diseases. We have recently shown that salt has a proinflammatory effect and boosts the activation of Th17 cells and the activation of classical, LPS-induced macrophages (M1). Here, we examined how the activation of alternative (M2) macrophages is affected by salt. In stark contrast to Th17 cells and M1 macrophages, high salt blunted the alternative activation of BM-derived mouse macrophages stimulated with IL-4 and IL-13, M(IL-4+IL-13) macrophages. Salt-induced reduction of M(IL-4+IL-13) activation was not associated with increased polarization toward a proinflammatory M1 phenotype. In vitro, high salt decreased the ability of M(IL-4+IL-13) macrophages to suppress effector T cell proliferation. Moreover, mice fed a high salt diet exhibited reduced M2 activation following chitin injection and delayed wound healing compared with control animals. We further identified a high salt–induced reduction in glycolysis and mitochondrial metabolic output, coupled with blunted AKT and mTOR signaling, which indicates a mechanism by which NaCl inhibits full M2 macrophage activation. Collectively, this study provides evidence that high salt reduces noninflammatory innate immune cell activation and may thus lead to an overall imbalance in immune homeostasis.

Go to:
Introduction
High intake of dietary salt (NaCl) has been implicated in cardiovascular disease (1, 2), chronic inflammation (3), autoimmune diseases (4), and cancer (5). The effect of salt on hypertension has been well established; however, controversy remains as to precisely what level of NaCl intake is safe (1, 6, 7), highlighting a poor understanding of underlying mechanisms. While genetics strongly contributes to the development of the above diseases (8–11), the marked rise in autoimmune and inflammatory disease incidence suggests that environmental factors such as the Western diet, high in both sodium and fat, might play a role. On high-salt diets (HSDs), both humans and experimental animals do not exhibit elevated plasma sodium levels, due to tight renal regulation of plasma electrolytes. In contrast, we have described an unexpected storage compartment where sodium accumulates within the skin and muscle via a mechanism independent of the kidney (12–17). This increase in interstitial sodium has been calculated to be approximately 40 mM greater than that measured in plasma (17–20). Interestingly, lymphoid tissues also display a higher osmolarity (19, 21). The influence of increased osmolarity in certain compartments of the body on the activation, function, and recruitment of immune cells has been the focus of research (16, 18, 22, 23).

We and others have shown that proinflammatory Th17 cells have a boosted activation when cultured with cytokines in the presence of an additional 40 mM NaCl (22, 24). In this study, serum- and glucocorticoid-regulated kinase 1 (SGK1) and tonicity-responsive enhancer binding protein (TonEBP, also known as NFAT5) were identified as key mediators of this salt-augmented activation of Th17 cells. Additionally, HSD accelerated and aggravated murine experimental autoimmune encephalitis (22, 24). More recently, we have shown that so-called classically activated, or M1 proinflammatory macrophages (e.g., those stimulated with LPS), also exhibit exaggerated responses when activated in the presence of high NaCl (18). Macrophages are highly heterogeneous immune cells with a continuous spectrum of activation states (25); at the opposite end to M1-activated macrophages are the alternatively activated M2 macrophages (e.g., those stimulated with IL-4 and IL-13) (26). M2 macrophages have been shown to play central roles in mediating Th2 immunity, wound healing, and the suppression of effector T cell function, and they are not considered proinflammatory (27). In addition, M2 macrophages have been shown to be important in preventing the development of autoimmune diseases (28–30), while their contribution to hypertension and cardiovascular diseases is largely unknown.

Several signaling pathways and transcription factors have been shown to be important for the activation of M2 macrophages. This includes the STAT6, which becomes phosphorylated following recruitment to the IL-4 and IL-13 receptors after the binding of their cognate cytokines (31, 32). While the acquisition of a M2 state is primarily reliant on STAT6 signaling, it has recently been shown that the long-term maintenance and augmentation of this phenotype is dependent on cellular metabolism. This is driven by key metabolic regulators, including the peroxisome proliferator receptor γ (PPARγ) (33, 34), carbohydrate kinases (35), and lysosomal acid lipase (36), and by the nutrient-sensing signaling pathways Akt and mTOR (37).

In this study, we have examined how the activation of M(IL-4+IL-13) macrophages (our in vitro–generated M2 macrophages; nomenclature according to ref. 26) is affected by NaCl-induced hypertonicity. In contrast to our previous studies with proinflammatory immune cells, we find that NaCl blunts the activation of M(IL-4+IL-13) macrophages in a Sgk1- and Nfat5-independent manner. The reduced M(IL-4+IL-13) activation was not associated with acquisition of a proinflammatory M1 phenotype. We further identify perturbations in Akt signaling and the metabolic capacity of M(IL-4+IL-13) macrophages, indicating a new mechanism by which salt modulates immune cell function. This study shows that increased salt also perturbs antiinflammatory immune cells and, thus, might further imbalance immune homeostasis.

Go to:
Results
Salt blunts M(IL-4+IL-13) macrophage activation.
Macrophages were produced from the BM of C57BL/6 mice (BM-derived macrophages, BMDM) and stimulated with IL-4 and IL-13 for 24 hours. To determine the effect of salt on their activation, we increased the concentration of NaCl in the media by an additional 40 mM, i.e., from 139 mM (normal, isotonic media) to 179 mM (this condition is hereafter referred to as high salt; Figure 1A). This increase in sodium of an additional 40 mM was chosen since it mimics the interstitial accumulation of NaCl in rodents on HSDs (17–20). The activation of M(IL-4+IL-13) macrophages is typically characterized by the induction of a panel of signature genes: Arg1 (arginase 1), Mrc1 (mannose receptor), Fizz1 (resistin-like α), Ym1 (chitinase-like 3), Mgl2 (macrophage galactose-type C-type lectin 2), and Slamf1 (signaling lymphocyte activation molecule 1). Activation in the presence of this additional 40 mM NaCl for 24 hours significantly blunted the upregulation of these genes (Figure 1B) but was not associated with a reduction in the overall purity of the macrophage cultures (defined as F4/80+CD11b+), cell size (Supplemental Figure 1), or cell viability (Supplemental Figure 2). We observed a NaCl dose response, where a reduction in M(IL-4+IL-13) signature gene expression was observed with an increase of only 10 mM NaCl, with 40 mM producing a maximal response (Supplemental Figure 3). Decreased viability was observed only at much higher concentrations of NaCl (>80 mM) (data not shown). Moreover, we observed that the sodium ion was essential for this effect, as stimulation with sodium gluconate similarly blunted M(IL-4+IL-13) signature gene expression (Figure 1C). We next examined the effect of salt on M(IL-4+IL-13) signature gene expression over time and observed a reduced expression of several genes at early time points (1 and 3 hours) (Supplemental Figure 3). Furthermore, at extended stimulation times, we observed an even greater reduction in M(IL-4+IL-13) signature gene expression, which — in the case of Mrc1, Fizz1, and Mgl2 — equalized after 1 week (Supplemental Figure 3). We also addressed whether preactivated macrophages were similarly sensitive to increased NaCl. The salt-blunted expression of Ym1, Arg1, and Mrc1 was rescued by first incubating macrophages alone with IL-4+IL-13 for 24 hours, before increasing the concentration of NaCl by 40 mM for another 24 hours (Supplemental Figure 4). Finally, in vivo differentiated macrophages isolated from the peritoneal cavity of C57Bl/6 mice stimulated with IL-4+IL-13 were similarly affected by NaCl (Supplemental Figure 5).

Open in a separate window
Figure 1
High salt blunts the expression of M(IL-4+IL-13) signature genes.
(A) Schematic of in vitro stimulation of macrophages. Indicated is the final media concentration of Na+ per condition, where 139 mM is normal, isotonic media. BMC, BM cells. (B) Macrophages were stimulated with IL-4 and IL-13 (M[IL-4+IL-13]) in the absence (none) or with an additional 40 mM NaCl for 24 hours. Unstimulated (M[0]) macrophages were treated similarly. The expression of M(IL-4+IL-13) signature genes was determined by qPCR. The experiment was repeated at least 3 times independently. n = 6 (technical). *P < 0.05 vs. M(0) and #P < 0.05 vs. M(IL-4+IL-13) none by 1-way ANOVA. (C) Macrophages were stimulated with IL-4 and IL-13 as in B or with an additional 40 mM Na-gluconate for 24 hours, and signature gene expression was analyzed by qPCR. The experiment was repeated at least 3 times independently. n = 5 (technical). *P < 0.0001 vs. M(0); #P < 0.001 vs. M(IL-4+IL-13) none by 1-way ANOVA.

Our next question was whether the effect of NaCl on M(IL-4+IL-13) activation was simply due to an increase in tonicity, rather than a specific action of Na+/Cl–. To address this, we repeated the stimulation with IL-4+IL-13 in the presence of 2 nonionic osmolytes: mannitol, which increases tonicity but does not enter the cell, and urea, which increases osmolality and is able to pass through the cell membrane. In contrast to the effect with high salt, the addition of 80 mM urea or mannitol — which have equivalent osmolality and tonicity to 40 mM NaCl, respectively — did not blunt the induction of M(IL-4+IL-13) signature genes (Figure 2A). This differential effect was also observed by Western blotting, as NaCl specifically reduced the protein levels of ARG1, which was not affected by urea or mannitol (Figure 2B).

Figure 2
Effect of NaCl on M(IL-4+IL-13) activation is not related to changes in tonicity.
(A) Macrophages were stimulated with IL-4 and IL-13 in the absence (none) or with an additional 40 mM NaCl, or 80 mM urea or mannitol, as tonicity controls. Signature gene expression was analyzed by qPCR. The experiment was repeated at least 3 times independently. n = 6 (technical). *P < 0.0001 vs. M(0); #P < 0.05 vs. M(IL-4+IL-13) none and M(IL-4+IL-13) + mannitol; and †P < 0.01 vs. M(IL-4+IL-13) + urea by 1-way ANOVA. (B) Protein levels of ARG1 were determined by Western blotting after treatment, as in A. HSP60 loading control is also shown. Dot plots shows the quantification of the relative levels of ARG1 normalized to M(IL-4+IL-13) lysates, with n = 2–3 technical replicates and the pooling of 3 independent experiments (total n = 8). *P < 0.0001 (t test). (C) The effect of NaCl on the phosphorylation of STAT6 was determined by Western blotting. Macrophages were serum-starved overnight and then pretreated for 5 minutes with an additional 40 mM NaCl or 80 mM mannitol, prior to stimulation with IL-4+IL-13 for 15, 30, or 60 minutes. The levels of phosphorylated and total STAT6 were determined in separate blots, with β-actin used as loading control. The dot plot shows the quantification of relative levels of pSTAT6/STAT6 for each time point, normalized to t = 15 minutes of M(IL-4+IL-13) lysates, from the pooling of 2 independent experiments (n = 3 technical replicates).

The activation of M(IL-4+IL-13) macrophages is dependent on signaling through the transcription factor STAT6, where — upon its phosphorylation — it translocates to the nucleus to regulate transcription. To determine whether NaCl was affecting this process, macrophages were pretreated in isotonic media or with high salt for 5 minutes, before stimulation with IL-4 and IL-13. No effect was observed on STAT6 phosphorylation (Figure 2C), indicating that the ligation of IL-4 or IL-13 to their cognate receptors was not perturbed by high salt, nor were the molecular mechanisms essential for the phosphorylation of STAT6.

Salt does not induce an M1 phenotype in M(IL-4+IL-13)-activated macrophages.
We have recently shown that high salt augments the activation of proinflammatory LPS-stimulated macrophages, M(LPS) (18). In this study, we demonstrated that, in combination with LPS stimulation, NaCl boosted M(LPS) function by an increased expression of Nos2, augmenting nitrate production, and enhancing antimicrobial activity (18). As mentioned, macrophages have a spectrum of activation states, ranging from proinflammatory (e.g. M[LPS]) at one end, to the noninflammatory M(IL-4+IL-13) macrophages at the other (26). A shift from non- to proinflammatory macrophage activation is thought to be central to the development of autoimmune diseases (28–30) and inflammatory conditions, such as type 2 diabetes (38). We thus examined whether the blunted M(IL-4+IL-13) activation by NaCl (Figures 1 and and2)2) was accompanied by a shift toward proinflammatory macrophage activation. We examined several parameters of M(LPS) activation, including gene expression of specific M(LPS) markers Nos2, Il6, and Tnf (Figure 3, A and B), as well as genome-wide transcriptome (microarray) and epigenetic analysis (Figure 3C); the induction of a proinflammatory signaling pathway related to NF-κB (Figure 3D); and the protein expression of an M(LPS) surface marker, CD38, by flow cytometry (Figure 3E). In none of these analyses did we detect an induction of an M(LPS) phenotype in M(IL-4+IL-13) macrophages activated in high salt. Moreover, functional analyses of BMDM infected with leishmania parasites revealed that only M(LPS) macrophages stimulated in the presence of high salt produced a sufficient amount of nitrate in order to significantly affect L. major viability (Figure 3F). Taken together, the blunted M(IL-4+IL-13) activation with high NaCl is not accompanied by an increased polarization toward a proinflammatory M(LPS) phenotype.

Open in a separate window
Figure 3
Salt does not induce an M1 phenotype in M(IL-4+IL-13)-activated macrophages.
(A) BMDM were stimulated with LPS — M(LPS) — in the absence (none) or presence of an additional 40 mM NaCl or 80 mM mannitol for 24 hours. The expression of Nos2 was determined by qPCR. n = 6 (technical). *P < 0.001 vs. M(0); #P < 0.001 vs. M(LPS) none; and †P < 0.001 vs. M(LPS) + 80 mM mannitol. (B) Macrophages were activated to M(0), M(IL-4+IL-13), or M(LPS) as in A. Nos2, Il6, and Tnfa gene expression was determined by qPCR. n = 6 (technical). *P < 0.001 vs. M(0); #P < 0.05 vs. M(IL-4+IL-13) none; and †P < 0.05 vs. M(IL-4+IL-13) none and M(IL-4+IL-13) + 40 mM NaCl. (C) Macrophages were activated to M(0), M(IL-4+IL-13), or M(LPS) as in A, and genome-wide gene expression was determined by microarray. ChIP-seq was performed for H3K4me3 and H4ac chromatin modifications. Principle component (PC) analysis was performed on all genes in 2 independent, biological replicates. (D) Left: Macrophages were pretreated with an additional 40 mM NaCl and then stimulated with IL-4+IL-13 or LPS for 15, 30, or 60 min. The levels of phosphorylated and total IκBα were determined by Western blotting, with Hsp60 as control. Right: The expression of Ikba by qPCR. n = 6 (technical). *P < 0.01 vs. M(LPS). (E) CD38 surface expression as mean fluorescence intensity (MFI) by flow cytometry in macrophages activated to M(0), M(IL-4+IL-13), or M(LPS) alone (none) as in A. n = 2 technical replicates and the pooling of 3 independent experiments (total n = 6). *P < 0.01 vs. M(0) none, M(0) + 40 mM NaCl, M(IL-4+IL-13) none, and M(IL-4+IL-13) + 40 mM NaCl; and #P < 0.05 vs. M(LPS). (F) Left: The percentage of BMDM infected with Leishmania major after 72 hours. Right: Nitrate levels. The experiment was repeated independently 3 times and then pooled. n = 8–10 (technical). *P < 0.05 vs. M(0) none, M(0) + 40 mM NaCl, and M(IL-4+IL-13) none; **P < 0.01 vs. all other groups; #P < 0.0001 vs. M(IL-4+IL-13) + 40 mM NaCl; and †P < 0.001 vs. M(LPS) none. Statistics in A, B, and D–F were analyzed by 1-way ANOVA.

Reduction in M(IL-4+IL-13) suppressive capacity with activation in high salt.
Noninflammatory M(IL-4+IL-13) macrophages can suppress CD8+ and CD4+ T cell proliferation, which depends on STAT6 activation and cell-cell contact (32). To assess whether high salt had a functional effect on this suppressive capacity of M(IL-4+IL-13) macrophages, we established a macrophage/T cell coculture assay (Figure 4). Briefly, macrophages were preactivated to M(IL-4+IL-13) alone or in high salt for 24 hours before extensive washing to remove excess salt. Only after this procedure were macrophages cocultured with prestimulated splenocytes in isotonic media for a further 3.5 days. CD4+ T cells exhibited high levels of proliferation in the presence of nonactivated — M(0) — macrophages. The addition of preactivated M(IL-4+IL-13) macrophages inhibited CD4+ T cell proliferation. In contrast, T cell proliferation was significantly less suppressed by macrophages that were preactivated to M(IL-4+IL-13) in high salt (Figure 4, B and C). This effect was also observed at other T cell/macrophage ratios (Supplemental Figure 6). We also examined the macrophage cultures for the putative contamination of myeloid-derived suppressor cells (MDSCs) — a myeloid lineage immune cell that can be generated from BM cells and is also capable of suppressing T cell proliferation (39, 40). We detected extremely low proportions of MDSCs (<0.2%) in M(IL-4+IL-13)-activated macrophage cultures, which were not altered by additional NaCl, indicating that putative MDSC contamination is not contributing to our observed loss in T cell suppression (Supplemental Figure 1). Furthermore, since the suppressive ability of M(IL-4+IL-13) macrophages is shown to be mediated by cell-cell contact (32), we examined the expression of programmed cell death 1 ligand 2 (PD-L2) by flow cytometry (Figure 4D). Activation to M(IL-4+IL-13) resulted in a more than 2-fold increase in PD-L2 expression, which was reduced with high salt. This indicates that NaCl reduces the expression of the key-suppressive machinery of tolerogenic macrophages.

Figure 4
High salt reduces the suppressive capacity of M(IL-4+IL-13) macrophages.
(A) Schematic of the in vitro coculture assay. Briefly, macrophages were activated into M(IL-4+IL-13) with/without an additional 40 mM NaCl for 24 hours. Excess salt was then removed by repeated washing of the cells. Coculture of CFSE-labeled CD4+ T cells (from whole splenocytes) and preactivated macrophages occurred in the presence of plate-bound α-CD3 and α-CD28, but without any additional salt. CD4+ T cell proliferation was monitored by flow cytometry. (B) CFSE fluorescence histograms of gated CD4+ T cells incubated with macrophages at a ratio of 6:1 (T cell/macrophage). Macrophages were unactivated (M[0]) or activated with IL-4+IL-13 in the absence (none) or with high salt. (C) Quantification of B. Bars show the mean percentage of proliferating CD4+ T cells (n = 5 technical replicates). The experiment was repeated at least 3 times independently. *P < 0.05 vs. M(0) and #P < 0.05 vs. M(IL-4+IL-13) none by 1-way ANOVA. (D) The level of PD-L2 expression of macrophages from B was determined by flow cytometry. Numbers above each line indicate the mean fluorescence intensity. A similar trend was observed in 3 independent experiments.

HSD reduces chitin-elicited macrophage activation in vivo.
We next tested whether salt also affected M2 activation in vivo. We employed a well-established model to examine the IL-4–dependent activation of macrophages in the peritoneal cavity. Following i.p. injection of chitin ([C8H13O5N)]n), ARG1+ M2-like macrophages are induced in the peritoneal space (41). Subsequently, analysis of the expression of M2 signature genes in peritoneal exudate cells (PECs) is used as an indicator of the extent of M2 activation (37, 42). To examine the effect of salt on this process, C57BL/6 mice were fed a normal-salt diet (NSD) or an HSD for 14 days, before i.p. injection of chitin (Figure 5A). PECs were then isolated by lavage and analyzed by flow cytometry. There was no significant effect of HSD on the proportion or number of macrophages (Figure 5, B and C), or other major immune populations such as B cells, T cells, and negative cells (CD11b–F4/80–B220–CD3–) (Supplemental Figure 7). To examine the effect of HSD specifically on macrophage activation, we sorted PECs into the major immune populations described above by FACS (Figure 5D and Supplemental Figure 7), for subsequent gene expression analysis by quantitative PCR (qPCR) (Figure 5A). In line with the in vitro experiments (Figure 1), HSD resulted in a significant reduction in Arg1 and Fizz1 expression. HSD tended to decrease Ym1 expression — an effect, however, not reaching statistical significance (P = 0.07). Other M(IL-4+IL-13) signature genes, Mgl2 and Slamf1, were not reduced in isolated chitin-elicited macrophages (Supplemental Figure 7). Similar results were observed in unsorted, chitin-elicited adherent PECs, which were enriched for macrophages and B cells, and exhibited reduced Mrc1, Fizz1, and Mgl2 expression (Supplemental Figure 7). Taken together, the results indicate that HSD attenuates M2 activation in vivo.

Open in a separate window
Figure 5
HSD reduces M2 activation in vivo.
(A) Mice were fed an NSD or an HSD for 14 days, at which point chitin was injected i.p. After 2 days, PECs were collected from the i.p. space by lavage and the desired immune populations were sorted by FACS and analyzed by qPCR. (B) Representative flow cytometry plots showing staining for macrophages (CD11b+F4/80+) of PECs from mice on NSD and HSD. (C) Quantification from B of the proportion and actual number of macrophages in PECs from mice on each respective diet. n = 4 (biological). (D) Gating strategy for the isolation of the desired immune populations by FACS. Following the gating of macrophages (Mac; CD11b+F4/80+) cells were then gated on CD11b–F4/80– and subsequently sorted as B220+ (B cells), CD3+ (T cells), or B220–CD3– (Neg). The final purity of each sorted population is shown below, where macrophages were >85% and all other populations were >90%. (E) The expression of M2 signature genes in immune cell populations sorted from PECs as described in D. (n = 4 NSD vs. n = 4 HSD biological replicates). *P < 0.05, #P < 0.01, and †P < 0.0001 by 2-way ANOVA.

HSD leads to delayed wound healing in vivo.
Wound healing is a complex process, involving the coordinated action of multiple cell types to resolve inflammation and promote collagen deposition and tissue repair (43, 44). Upon wounding, macrophages are rapidly recruited to the site of injury, where M1-activated macrophages drive the initial proinflammatory response, followed by the infiltration of M2-activated macrophages for tissue healing and repair (45). While M2-activated macrophages play a key role in promoting wound healing, they are not solely responsible, since PU.1 KO mice — which lack macrophages, neutrophils, and mast cells — are still able to exhibit wound healing (46). To test the effect of salt, 2 cutaneous back wounds were inflicted to WT C57BL/6 mice, which were then fed NSD and HSD as before, and the closure of the wounds was monitored for a further 14 days (Figure 6A and Supplemental Figure 8). Mice on an HSD had no change in the rate of wound healing in the initial phase (0–3 days) but had a significant delay in wound healing during the later stages (3–7 days) (Figure 6, B and C). After 1 week, mice on an NSD exhibited a 69% reduction in wound area, while mice fed an HSD showed a delayed wound closure (56%). Additionally, mice on an HSD had only 6/13 wounds completely healed after 14 days, while only 1/13 wounds from mice on an NSD remained incompletely healed after 14 days (Figure 6D). These findings are reminiscent of a recent study that demonstrated that macrophage-specific KO of the transcription factor KLF4 perturbs M2 activation and in vivo wound healing at a similar rate and amount as what we observed (~70% reduction in WT vs. ~55% reduction in Klf4 KO after 8 days) (47). We also examined the expression of M(IL-4+IL-13) signature genes in wound samples (Figure 6E). By 2-way ANOVA, a significant effect of HSD was observed, particularly in Fizz1 expression. We have previously shown that HSD augments Th17 responses in vivo (22), and we also examined the skin expression of IL-17A in the same wound samples, comparing them to a prototype Th17 disease: psoriasis. In contrast to skin samples of animals affected with psoriasis, we did not observe any amplification of IL-17A (data not shown), indicating that Th17 responses do not play a major role in the wound-healing model employed here.

Open in a separate window
Figure 6
HSD leads to impaired wound healing in vivo.
(A) Two cutaneous wounds were applied to the back of mice, which were then fed an NSD or HSD for 14 days. The closure of the wounds was monitored at the desired times in this 14-day period, at the end of which skin samples from the wounded area were subjected to qPCR analysis. (B) Representative images of wounds from mice on an NSD and HSD during 14 days after wounding. (C) The percent change in wound area is plotted over time. The experiment was repeated twice independently, at which point the values from 7 individual mice were pooled (n = 13 wounds per group). *P < 0.05 and **P < 0.01 by 2-way ANOVA. (D) The number of wounds completely healed (gray) vs. incompletely healed (white) at the end of the experiment (14 days). (E) Real-time qPCR analysis of M2 signature genes at wound sites from mice on an NSD and HSD. The P value shown for the effect of HSD was calculated by 2-way ANOVA. **P < 0.01. n = 5 (biological).

Collectively, the data here demonstrates that HSD delays wound healing to a similar extent to that observed in other macrophage-specific KO models (47) and furthermore reduces the expression of M(IL-4+IL-13) signature genes in wound samples. However, it is highly plausible that HSD affects many other cell types important for wound healing (e.g., neutrophils and fibroblasts), so we cannot safely conclude that high salt impairs in vivo wound healing exclusively by reducing M2 activation. It would be interesting to study the effect of HSD on M2 activation in other in vivo models, such as helminth infection.

SGK1 and NFAT5 do not mediate NaCl effect in IL-4+IL-13–activated macrophages.
Our previous work showed that the augmentation of proinflammatory Th17 and M1 macrophage activation by salt was mediated via SGK1 and NFAT5 (18, 22). SGK1 is also important for the activation of Th2 cells in the absence of NaCl (48). However, upon activation to M(IL-4+IL-13) no induction of Nfat5 or Sgk1 was observed, which was only mildly upregulated with the addition of 40 mM NaCl (Supplemental Figure 9). This is in stark contrast to solute carrier family 6 member 12 (Slc6a12), which encodes a betaine transporter essential for the compensatory response of cells to high tonicity (49), which exhibited a high level of upregulation upon the addition of 40 mM NaCl. Furthermore, Nfat5 and Sgk1 KO BMDM stimulated with IL-4+IL-13 were unaffected and showed robust induction of M(IL-4+IL-13) signature genes, and importantly, failed to rescue the effect of NaCl on M(IL-4+IL-13) signature gene expression (Supplemental Figure 9). Collectively, this indicates that NaCl mediates its effect on M(IL-4+IL-13)-activated macrophages via a different mechanism to that described for proinflammatory immune cells such as Th17 cells and M1-activated macrophages (18, 22, 24).

Salt modifies epigenetic marks important for M(IL-4+IL-13) activation.
Our data indicates that salt attenuates the activation and function of M(IL-4+IL-13) macrophages. However, this effect was not mediated by blunted STAT6 signaling or reduced cell viability, by inducing transactivation into a proinflammatory phenotype, nor via a known proinflammatory/tonicity-responsive pathway involving the molecules NFAT5 and SGK1. It has been demonstrated that the reduced epigenetic modifications of a nodal M(IL-4+IL-13) transcription factor, Irf4, resulted in a decreased induction of signature genes (42). Since we also identified that the induction of Irf4 was affected by salt (data not shown), we hypothesized that salt may modulate epigenetic signatures essential for M(IL-4+IL-13) activation. We performed further analysis of our genome-wide epigenetic data (Figure 3C), where we performed ChIP with antibodies against 2 transcriptionally activating chromatin marks: histone 3 lysine 4 trimethylation (H3K4me3) and histone 4 acetylation (H4ac), followed by sequencing (ChIP-seq). We identified 2,568 genes that were differential (false discovery rate [FDR] < 0.05) in transcription, H3K4me3 or H4ac, or various combinations, upon stimulation with IL-4+IL-13 in normal, isotonic media (Supplemental Tables 1 and 2). As both H3K4me3 and H4ac have been identified to be important for the activation of gene expression, we further analyzed only those genes that simultaneously had an increased gene expression upon IL-4 and IL-13 stimulation (803 genes; Figure 7, A and B, and Supplemental Table 2). We identified 3 types of gene clusters upon activation to M(IL-4+IL-13); all clusters contained genes with induced expression and then had either a concordant increase, decrease, or no change in either of the chromatin modifications (Figure 7C). We then evaluated the effect of high salt on these 2 chromatin modifications. Overall, several M(IL-4+IL-13) genes had a reduction in H3K4me3 marks (Figure 7C, left), while more genes had increased H4ac reads on activation with high salt (Figure 7C, right, Supplemental Figure 10, and Supplemental Table 2). Two M(IL-4+IL-13) signature genes (Mgl2 and Slamf1) had clearly reduced H3K4me3 marks at their transcription start sites (TSS) in M(IL-4+IL-13) macrophages activated with an additional 40 mM NaCl (Figure 7D). This was not the case for M(LPS)-activated macrophages, which did not show any H3K4me3 marks around the Mgl2 TSS and, interestingly, exhibited an increased amount of H3K4me3 around the Slamf1 TSS, which was further augmented on LPS stimulation in high salt (Figure 7D). Additionally, Slc6a12, a tonicity-responsive channel that showed the highest upregulation in gene expression upon treatment with high salt alone or in combination with ILs or LPS, also displayed an induction in both H3K4me3 (Figure 7D) and H4ac marks (data not shown). Collectively, these results indicate that M(IL-4+IL-13) activation in the presence of NaCl results in a mild change in posttranslational histone modifications at the TSS of several genes important for M(IL-4+IL-13) induction.

Open in a separate window
Figure 7
Salt modifies epigenetic marks of M(IL-4+IL-13) genes.
(A and B) ChIP-seq was performed to identify the effect of salt on transcriptionally activating epigenetic modifications upon M(IL-4+IL-13) induction. Only genes that had a corresponding increased gene expression upon M(IL-4+IL-13) activation were analyzed further. The H3K4me3 (A) and H4ac (B) marks (counts) upon activation to M(IL-4+IL-13) in the absence (none) or presence of 40 mM NaCl is presented. M(IL-4+IL-13) signature genes analyzed in Figure 1 and Slc6a12 are indicated on each graph. A single technical replicate was generated for each group, which was repeated in 2 independent experiments and then pooled (total of n = 2). (C) Summary of the effect of M(IL-4+IL-13) activation on genes with an increased expression and either a concordant increase (>1.3-fold), no change (nc), or decrease (<0.7-fold) in H3K4me3 and H4ac chromatin marks. The number of genes that were changed (>1.2-fold) upon activation in the presence of an additional 40 mM NaCl is shown. n = 2 (biological). (D) Representative H3K4me3 counts around the promoter region of M(IL-4+IL-13) signature genes Mgl2 and Slamf1, and the tonicity responsive molecule Slc6a12. The total H3K4me3 counts were normalized by library size.

Salt modulates M(IL-4+IL-13) cellular metabolism.
We next performed detailed analyses of changes in the transcriptional program of M(IL-4+IL-13) macrophages activated in isotonic media, or with an additional 40 mM NaCl, with the aim to identify disturbances in pathways or individual genes that may account for our observed blunted activation with salt. Of the 803 genes that were upregulated upon induction from M(0) to M(IL-4+IL-13), 259 of these differed (increased or reduced) by more than 1.2-fold when similarly activated in high salt (Figure 8A). Of note, M(IL-4+IL-13) signature genes identified in Figure 1B to be affected by high salt had a similarly blunted induction in the microarray. Additionally, Slc6a12 had a similarly increased gene expression to that shown previously. To identify pathways and/or cellular programs affected by salt, we performed gene ontology (GO) analysis on the 259 salt-sensitive M(IL-4+IL-13) genes. The top 20 GO terms are shown. Notably, many terms that were related to immune cell activation and proliferation were identified as being affected upon activation in the presence of high salt, supporting the functional results presented in Figures 4–6. Additionally, several terms related to cellular metabolism were identified.

Open in a separate window
Figure 8
Salt modulates M(IL-4+IL-13) cellular metabolism.
(A) Macrophages were activated to M(IL-4+IL-13) ± high salt for 24 hours as before, and gene expression was analyzed by microarray. M(IL-4+IL-13) signature genes from Figure 1 and Slc6a12 are indicated. Salt-modulated M(IL-4+IL-13) genes were subjected to GO analysis (right). The top 20 GO terms (FDR < 0.065) are shown. (B) Schematic of the major cellular metabolic pathways: glycolysis and OXPHOS. (C) OCR of unstimulated (M[0]) or M(IL-4+IL-13)-activated macrophages without (none) or with high salt for 24 hours, followed by sequential treatment with Oligomycin (to inhibit mitochondrial respiration), FCCP (to elucidate maximal respiration), and rotenone plus antimycin A (Rot+A) (to measure nonmitochondrial respiration). Also basal OCR, basal ECAR, and SRC in 3 independent experiments were pooled (total n = 14). *P < 0.05 vs. M(0) and #P < 0.05 vs. M(IL-4+IL-13). (D) Mitochondrial mass by staining cells with MitoTracker red and flow cytometry. n = 6 (2 independent experiments pooled). (E) Mitochondrial content was measured by the ratio of mitochondrial (mt) DNA to nuclear (N) DNA. n = 5 (technical). (F) ECAR of M(0) or M(IL-4+IL-13) activated as in C, followed by sequential treatment with glucose (to initiate glycolysis), Oligomycin, and 2-deoxy glucose (DG) (to inhibit glycolysis). The rate of glycolysis was calculated based on the difference between basal ECAR and the maximal ECAR, following glucose stimulation. Two independent experiments were pooled (total n = 10). *P < 0.05 vs. M(0) and #P < 0.05 vs. M(IL-4+IL-13). (G) One-hour lactate production from supernatants by fluorometric assay. Two independent experiments were pooled (total n = 7). (H) Glucose uptake of macrophages activated as indicated for 24 hours, followed by incubation of the cells with 2NB-DG for 1 hour and analysis by flow cytometry. Three independent experiments were pooled (total n = 9). *P < 0.05 vs. M(0) none. Statistics in C, F, and H) were analyzed by 1-way ANOVA.

Cellular metabolism or respiration is essential for the general growth, survival, and proliferation of all cell types. It is characterized by 2 major pathways: glycolysis and oxidative phosphorylation (OXPHOS) (Figure 8B). While glycolysis produces far less ATP than OXPHOS, it has several advantages in that it is quick and yields metabolic intermediates required for growth and proliferation (50). It has been demonstrated in a number of recent publications (51–55) that activated immune cells frequently undergo large metabolic “switches” to use predominantly glycolysis or OXPHOS in order to cope with the increased metabolic demands associated with activation. This includes macrophages where, upon activation, M1 macrophages become glycolytic and M2 macrophages instead primarily rely on OXPHOS and fatty acid oxidation to meet their metabolic requirements (36).

To validate the GO term results from above and explore if NaCl modulates cellular metabolism, we conducted extracellular flux analysis of M(0) and macrophages activated for 24 hours to M(IL-4+IL-13) alone or in high salt. In line with previous studies (35, 36), activation to M(IL-4+IL-13) resulted in an increase in the basal mitochondrial oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) (Figure 8C). We next calculated the spare respiratory capacity (SRC), which provides information regarding the maximal mitochondrial respiration of the cell. Activation to M(IL-4+IL-13) in high salt resulted in a significant decrease in SRC, indicating that NaCl blunts the OXPHOS capacity of these activated macrophages (Figure 8C). This was not associated with a decreased mitochondrial mass (Figure 8D) or content (Figure 8E). Interestingly, the opposite was true for unstimulated — M(0) — macrophages incubated with an additional 40 mM NaCl, which instead had an increased SRC (Figure 8C).

We next explored whether glycolysis in M(IL-4+IL-13)-activated macrophages was similarly affected by the addition of 40 mM NaCl. Again, extracellular flux analyses were performed of M(0) and M(IL-4+IL-13) macrophages activated for 24 hours, followed by exchange into glucose-free media, and then the maximal response of the cells upon stimulation with glucose was used as a measure of the rate of glycolysis (Figure 8F). Activation of M(IL-4+IL-13) in isotonic media was associated with an increase in glycolysis, which was, again, reduced in M(IL-4+IL-13) macrophages activated in an additional 40 mM NaCl. The opposite was true for unstimulated — M(0) — macrophages incubated with an additional 40 mM NaCl, which instead had an increased rate of glycolysis. Finally, we analyzed the amount of lactate production and glucose uptake in 1 hour. No difference in lactate production was observed (Figure 8G); however, NaCl-treated M(0) and M(IL-4+IL-13) macrophages took up significantly less fluorescently labeled glucose (NBDG; Figure 8H). Collectively, these analyses indicate that high NaCl blunts the increase in OXPHOS and glycolysis necessary for M(IL-4+IL-13) activation.

High NaCl blunts the induction of AKT and mTOR signaling.
As both the gene expression and extracellular flux experiments revealed that salt alters cellular metabolism, we next hypothesized that AKT/mTOR signaling might be affected, as these signaling pathways are known to be important for nutrient sensing and orchestrating the “switches” in metabolism necessary for immune cell activation. Furthermore, AKT signaling was recently identified to synergize with STAT6 signaling to ensure full commitment to an M(IL-4) activation state (37). To investigate this, we pretreated macrophages in isotonic media or high salt for 5 minutes, before stimulation with IL-4 and IL-13. Upon stimulation with IL-4+IL-13, an increase was evident in the phosphorylation of AKTS473 and p70S6KT389, a downstream target of mTOR signaling that is itself downstream of pAKT signaling (Figure 9A). The increased phosphorylation of both proteins with IL-4+IL-13 was blunted upon stimulation in the presence of high salt. We next investigated the effect of AKT inhibition (with the inhibitor LY294002) on the expression of our panel of M(IL-4+IL-13) signature genes. AKT inhibition attenuated the activation of M(IL-4+IL-13) signature genes (Figure 9B) — a result similar to that observed previously with M(IL-4) expression (37).

Open in a separate window
Figure 9
High NaCl blunts the induction of AKT and mTOR signaling.
(A) The effect of NaCl on AKT phosphorylation was determined by Western blotting. Macrophages were serum-starved overnight and then pretreated with 40 mM NaCl for 5 minutes, prior to stimulation with IL-4+IL-13 for 15, 30, or 60 minutes. The levels of total AKT were determined in a separate blot, with β-actin as a loading control. Also shown is phospho-p70S6K. Quantification of phospho-AKT/total AKT levels, normalized to t = 0, was obtained by pooling the mean levels from 3 independent experiments (total n = 4). *P < 0.05 vs. M(IL-4+IL-13) none by 2-way ANOVA. (B) Macrophages were stimulated with IL-4 and IL-13 in the absence (none) or with an additional 40 mM NaCl, or with an AKT inhibitor (LY294002, 50 μM) for 24 hours, and signature gene expression was analyzed by qPCR. n = 5 (technical). *P < 0.05 vs. M(0) none and M(0) + 40 mM NaCl; #P < 0.001 vs. M(IL-4+IL-13) none; †P < 0.001 vs. M(IL-4+IL-13) + 40 mM NaCl; and ‡P < 0.05 vs. M(IL-4+IL-13) + LY294002 none by 1-way ANOVA. (C) Schematic for the generation of BMDM with constitutively active Akt (NH[2]-terminally myristoylation signal-attached AKT; MyrAkt). Western blot (right) shows a robust induction of phosphorylated AKT after treatment of BMDM MyrAkt macrophages with TAT-Cre for 2 days. BMDM from WT macrophages treated with TAT-Cre similarly are shown. (D) BMDM from WT and MyrAkt mice were treated with TAT-Cre as in C and then stimulated with IL-4 and IL-13 in the absence (none) or with an additional 40 mM NaCl for 24 hours, and signature gene expression was analyzed by qPCR. Two independent stimulations were performed, which were then pooled (total n = 10–12 technical). *P < 0.05; **P < 0.01; and ***P < 0.001 by 2-way ANOVA.

We next generated BMDM from transgenic mice that express constitutively active Akt (MyrAkt). In this model, MyrAkt expression is inducible, so BM cells were first differentiated into BMDM — in the absence of Cre recombinanse — to ensure that the development of macrophages from MyrAkt mice was identical to WT controls (MyrAktinactive). Following the 7-day differentiation procedure, recombinant Cre recombinase (TAT-Cre) was added to induce excision of the stop cassette and thus MyrAkt expression (MyrAktactive). A high level of basal Akt phosphorylation was observed in MyrAktactive BMDM (Figure 9C). MyrAktactive and WT BMDM were then left unstimulated, or stimulated with IL-4+IL-13 alone or with an additional 40 mM NaCl for 24 hours, and expression of M2 signature genes was measured. As before, WT BMDM exhibited a significantly reduced induction of the genes Mrc1, Ym1, and Mgl2 when stimulated with IL-4+IL-13 in the presence of an additional 40 mM NaCl. However, this blunted expression by NaCl was rescued in MyrAkt BMDM (Figure 9D). Taken together, these results suggest that blunted Akt may contribute to the reduction of M2 macrophage activation with high salt.

Go to:
Discussion
We have shown here that a modest, and physiologic, increase in salt significantly reduces the activation of M(IL-4+IL-13) macrophages. Importantly, this also translated to an effect on M2 function in vivo. Different from our previous studies with Th17 cells (22) and proinflammatory M(LPS) (18), the effect by salt on M(IL-4+IL-13) macrophages was independent of the salt-responsive molecules SGK1 and NFAT5. In contrast, we found the action of salt to be mediated via perturbations in AKT/mTOR signaling and cellular metabolism.

Sodium ions seem to play an essential role in the effect described here, as the induction of hypertonicity by nonionic osmolytes, such as mannitol and urea, did not reduce M(IL-4+IL-13) activation. In our previous studies with Th17 cells (22) and M(LPS) macrophages (18), we revealed that sodium mediated its effect by boosting a proinflammatory SGK1-NFAT5 signaling cascade. These molecules are activated by p38/MAPK, a homologue to HOG1, the ancient yeast hypertonic stress response element that is considered part of a proinflammatory signaling cascade important for the development of inflammation (56). In the current study, we found no evidence for Sgk1 or Nfat5 in mediating the effect of salt on M(IL-4+IL-13) activation; however, this is in fact not surprising. M(IL-4+IL-13) macrophages are not considered to be proinflammatory, so IL-4+IL-13 stimulation does not activate this signaling cascade (26). Furthermore, we do not observe that stimulation with IL-4+IL-13 in high NaCl leads to the acquisition of a proinflammatory phenotype. Taking these previously published studies (18, 22) together with our present results, we propose that high NaCl does not trigger a general and nonspecific effect on macrophage activation. Rather, we hypothesize that, in combination with specific stimuli, NaCl either augments (e.g., with LPS) or reduces (e.g., with IL-4+IL-13) the signaling pathways and cellular processes essential for macrophage activation (Figure 10). Furthermore, we also observe in the current study that unstimulated M(0) macrophages treated with high salt have increased cellular metabolism (glycolysis and OXPHOS) and a slightly decreased viability, indicating that, in the absence of a stimulus, NaCl affects macrophage function again differently (Figure 10). Additionally, in a recent study, Ip et al. have described that LPS preactivated macrophages have enhanced inflammasome activation and IL-1β secretion with high-salt stimulation (57), indicating that the timing by which the macrophage experiences the stimuli, and salt again differentially modulates activation. In vivo, we thus postulate that the effect of NaCl on macrophage activation and function is governed by the environmental milieu bathing macrophages. Thus, elucidation of the effect of NaCl on macrophage activation in combination with other stimuli and environmental milieu will be crucial for understanding the consequence of high salt on macrophage function in vivo.

Figure 10
Summary of the effect of high NaCl on the activation of macrophages.
In the presence of noninflammatory signals (e.g., IL-4 and IL-13), this study has shown that NaCl reduces macrophage activation. In contrast, with a proinflammatory stimuli (e.g., LPS), salt augments macrophage activation (18). Furthermore, without a stimulus, M(0) macrophages exhibit an altered homeostasis. Together, we hypothesize that NaCl does not have a general and nonspecific effect on macrophages homeostasis, but rather, its effect is orchestrated via modulating specific signaling pathways and cellular processes essential for macrophage activation.

We propose here that blunted AKT/mTOR signaling and cellular metabolism is a mechanism by which high salt reduces M(IL-4+IL-13) activation. AKT was recently shown to be important in synergizing with STAT6 signaling to acquire complete M(IL-4) activation (37). In their study, the attenuation of AKT signaling, either by genetic modulation or chemical inhibition, resulted in an impaired M(IL-4) activation, independent of an effect on STAT6 phosphorylation (37). Byles et al. additionally identified a regulatory loop between AKT/mTOR upon stimulation of macrophages with IL-4 (37). In support of this, we additionally observed impaired activation of a downstream target of AKT, mTOR (p70S6K). Furthermore, with constitutive active AKT signaling, we were able to rescue the effect of NaCl on reducing M(IL-4+IL-13) gene expression.

Since AKT/mTOR is known to regulate cellular responses to changes in nutrient and energy availability, we hypothesized that an outcome of this decreased signaling would be a reduction in M(IL-4+IL-13) cellular metabolism. We have demonstrated that M(IL-4+IL-13) macrophages, like M(IL-4), depend mainly on OXPHOS (36). While high-salt treatment did not affect basal OCR, it reduced the mitochondrial respiratory reserve of M(IL-4+IL-13) macrophages and furthermore reduced the rate of glycolysis and glucose uptake. Taken together, these effects point toward reduced energy availability for full activation of M(IL-4+IL-13) macrophages stimulated in high NaCl. Similar to this, it was recently shown that chemically blocking fatty acid oxidation with etoxomir caused a decreased mitochondrial oxygen consumption and subsequently led to a reduction in M(IL-4) signature gene expression and function (36), supporting our notion that reduced metabolism can blunt M2 activation. In light of many recent publications demonstrating that the proper activation and function of many different immune cells is acutely sensitive to changes in cellular metabolism (35, 36, 51, 53, 55, 58), our results suggest a mechanism by which a subtle change in extracellular salt could affect a number of different immune cells by causing alterations in cellular metabolism. This mechanism has recently been described for several other components of the cellular microenvironment, where it was shown that subtle, local changes in molecules such as galactose (58), lactate (59), and succinate (60) had profound effects on the activation of immune cells that experience this altered environment. Interestingly, Tregs have an analogous metabolism to M(IL-4+IL-13) where they predominantly employ mitochondrial OXPHOS. In contrast, proinflammatory M(IFN-γ+LPS) macrophages and Th17 cells primarily utilize glycolysis to meet their bioenergenetic demands (36, 61). Therefore, it is tempting to speculate that a shift toward high glycolysis is a hallmark of inflammatory cells, whereas OXPHOS is a hallmark of noninflammatory cells (62). Determining how salt modulates the cellular metabolism of proinflammatory immune cells is the focus of our future work. While we have focused here (and in our previous studies) on extracellular salt and its effect on immune cell activation, we acknowledge that other molecules may be similarly modulatory in vivo. Therefore, we propose that detailed identification of the composition (e.g., electrolytes and metabolites) of microenvironments where immune cells reside — under physiological and pathological conditions — and subsequent determination of the effect of these molecules on immune cell activation will be essential information for further understanding of a number of diseases, including cardiovascular, infectious, and autoimmune diseases.

The effect of salt on immune cells may not necessarily be only pathogenic. Under physiological conditions, we postulate that the storage of sodium within the interstitial space primes effector immune cells, so when they encounter secondary signals from cytokines and antigens, they can mount a rapid and strong response (18, 22). The regulation of the concentration of this interstitial sodium is thus of high importance for physiology; this has been shown by us to be regulated by residing unactivated macrophages via a VEGF-C and lymphatic hyperplasia axis (16, 17). However, under conditions of dietary excess (e.g., with the Western diet) and with predisposing genetic influences, the concentration of sodium that immune cells are exposed to may rise. Taken together with our previous study where salt augmented Th17 and M(LPS) activation (18, 22), we postulate that excessive and chronic sodium chloride intake causes immune cells to experience higher sodium concentrations and thus creates an overall proinflammatory environment; the activation of proinflammatory cells such as Th17 and M(LPS) macrophages are boosted, while cells such as M(IL-4+IL-13) macrophages are disfavored. Collectively, we hypothesize that the overall balance between effector and regulatory arms of the immune system is disturbed by salt. Future studies to elucidate mechanisms that may influence changes in sodium storage will thus be essential for understanding the increased incidence of inflammatory and autoimmune diseases in Western societies.

Go to:
Methods
Please see the Supplemental Methods for full experimental procedures, including Supplemental Figure 11 and Supplemental Tables 3 and 4.

Mice.
Primary cultures of macrophages were generated from the BM of male 10–12 week old WT (C57BL/6JOlaHsd; Harlan), Sgk1 KO (Sv129J) (63), Nfat5 inducible-KO mice (C57BL/6; ERT2-CreER, Nfat5fl/fl) (64), or MyrAkt inducible-expression mice (Klaus Rajewsky MDC, Berlin, Germany). Female mice were not included in this study. Mice were fed normal chow diets (V1124-300, Ssniff) unless indicated. Mice were housed under standard light-dark–cycled conditions with SPF conditions. Mice were observed daily in order to minimize harm.

In vitro activation of BMDMs.
Mouse BM cells were differentiated into macrophages by cultivation in normal isotonic DMEM media supplemented with L929-generated CSF-1 for 7 days. For activation experiments, macrophages were exchanged into normal isotonic RPMI media ([Na+] = 139 mM), which did not contain CSF-1, and were then left unstimulated or stimulated with recombinant mouse IL-4 (10 ng/μl) and IL-13 (10 ng/μl) for 24 hours. For the analysis of the effect of salt, an additional 40 mM of NaCl was added to the media, resulting in a final concentration of Na+ of 179 mM. Tonicity experiments were performed in the same manner, where an additional 80 mM urea or 80 mM mannitol — which have an equivalent osmolality and tonicity to 40 mM NaCl, respectively — were added.

Assessment of HSD on M2 macrophage activation.
For all in vivo experiments, male age-matched C57BL/6JOlaHsd mice (Harlan) were randomly assigned to receive an HSD (4% NaCl in chow plus 1% in the drinking water) or an NSD (0.4 % in chow plus tap water) for 14 days. Diets were obtained from Ssniff. The injection of chitin was performed essentially as described previously (37). For the assessment of HSD on wound healing, two 8-mm excisional wounds, one on each side of the midline of the back, were applied. The length and width of the wounds were then measured for a further 14 days. The percent total wound area was calculated, compared with day 0 of the respective animal.

Statistics.
All data is presented as mean ± SEM. For in vivo experiments, no animals were excluded from analysis, while for in vitro experiments, outliers were first excluded using a Grubbs’ statistical test. Normality of data was assessed according to the Kolmogorov-Smirnov test and was then analyzed by either 2-sided Student’s t tests (parametric) or a Mann-Whitney U test (for nonparametric data). For analysis of more than 2 groups, 1-way ANOVA (parametric) or Kruskal-Wallis (nonparametric) tests were performed and, for all significant outcomes, a Tukey’s or Dunn’s (respectively) post hoc comparison was performed, after confirming the homogeneity of variances by Levene’s test. Analysis of pAKT levels by Western blotting was done by 2-way repeated measures ANOVA. All tests were 2-sided. Exact P values are presented when significance was obtained. The number of animals for statistical power was chosen based on analysis of previous studies investigating the influence of NaCl on immune cell function (ref. 22; n = 12), activation of M2 in vivo by chitin administration (ref. 37; n = 5), or assessment of wound healing (ref. 47; n = 9). In vivo experiments were repeated independently twice and then pooled. For in vitro experiments, an appropriate number of technical replicates was used to obtain statistical power; this depended on the number of groups analyzed and was determined based on previous experience. All in vitro experiments were repeated at least 3 times independently (biological replicates).

Study approval.
Animal experiments were approved by LAGeSo (Berlin, Germany) and Regierung von Mittelfranken (Ansbach, Germany).

Accession numbers.
The microarray and ChIP-seq datasets are available in the EMBL-EBI database (The European Bioinformatics Institute < EMBL-EBI) under the accession numbers E-MTAB-3163 and E-MTAB-3140, respectively.

Go to:
Supplementary Material
Supplemental data:
Click here to view.(4.0M, pdf)
Supplemental Table 2:
Click here to view.(686K, xlsx)
Go to:
Acknowledgments
We would like to thank Jana Czychi, Lajos Marko, Gabriel N’Diaye, Britta Schlund, Eva Bauer, Jennifer Hähnel, and Michaela Arend for their advice and technical assistance; Tomoharu Yasuda, Sandrine Sander, and Klaus Rajewsky (MDC, Berlin, Germany) for their suggestions; and Thomas Rathjen (MDC, Berlin, Germany) for assistance with the seahorse experiments. D.N. Müller, J. Jantsch, D. Voehringer, and J. Titze were supported by the DFG. The German Centre for Cardiovascular Research (DZHK) supported D.N. Müller (BER 1.1 VD). M. Gebhardt was supported by the TransCard Program (MDC Berlin). The German Ministry for Economics and Technology (50WB1218), the Interdisciplinary Center for Clinical Research Erlangen, and the NIH (RO1 HL118579-01) also supported J. Titze. K.J. Binger is a recipient of an Australian National Health and Medical Research Council C.J. Martin Fellowship (APP1037633).

Go to:
Footnotes
Conflict of interest: The authors have declared that no conflict of interest exists.

Reference information:J Clin Invest. 2015;125(11):4223–4238. doi:10.1172/JCI80919.

See the related Commentary beginning on page 4002.

Go to:
References
1. Mozaffarian D, et al. Global sodium consumption and death from cardiovascular causes. N Engl J Med. 2014;371(7):624–634. doi: 10.1056/NEJMoa1304127. [PubMed] [CrossRef] [Google Scholar]
2. He FJ, Li J, Macgregor GA. Effect of longer-term modest salt reduction on blood pressure. Cochrane Database Syst Rev. 2013;4: [PubMed] [Google Scholar]
3. Sundstrom B, Johansson I, Rantapaa-Dahlqvist S. Interaction between dietary sodium and smoking increases the risk for rheumatoid arthritis: results from a nested case-control study. Rheumatology (Oxford) 2014;54(3):487–493. [PubMed] [Google Scholar]
4. Farez MF, Fiol MP, Gaitán MI, Quintana FJ, Correale J. Sodium intake is associated with increased disease activity in multiple sclerosis. J Neurol Neurosurg Psychiatry. 2015;86(1):26–31. doi: 10.1136/jnnp-2014-307928. [PubMed] [CrossRef] [Google Scholar]
5. D’Elia L, Galletti F, Strazzullo P. Dietary salt intake and risk of gastric cancer. Cancer Treat Res. 2014;159:83–95. [PubMed] [Google Scholar]
6. Mente A, et al. Association of urinary sodium and potassium excretion with blood pressure. N Engl J Med. 2014;371(7):601–611. doi: 10.1056/NEJMoa1311989. [PubMed] [CrossRef] [Google Scholar]
7. O’Donnell M, et al. Urinary sodium and potassium excretion, mortality, and cardiovascular events. N Engl J Med. 2014;371(7):612–623. doi: 10.1056/NEJMoa1311889. [PubMed] [CrossRef] [Google Scholar]
8. Wain LV, et al. Genome-wide association study identifies six new loci influencing pulse pressure and mean arterial pressure. Nat Genet. 2011;43(10):1005–1011. doi: 10.1038/ng.922. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
9. Ehret GB, et al. Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. Nature. 2011;478(7367):103–109. doi: 10.1038/nature10405. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
10. Deloukas P, et al. Large-scale association analysis identifies new risk loci for coronary artery disease. Nat Genet. 2013;45(1):25–33. [PMC free article] [PubMed] [Google Scholar]
11. Beecham AH, et al. Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis. Nat Genet. 2013;45(11):1353–1360. doi: 10.1038/ng.2770. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
12. Titze J. Sodium balance is not just a renal affair. Curr Opin Nephrol Hypertens. 2014;23(2):101–105. doi: 10.1097/01.mnh.0000441151.55320.c3. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
13. Dahlmann A, et al. Magnetic resonance-determined sodium removal from tissue stores in hemodialysis patients. Kidney Int. 2015;87(2):434–441. doi: 10.1038/ki.2014.269. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
14. Kopp C, et al. 23Na magnetic resonance imaging-determined tissue sodium in healthy subjects and hypertensive patients. Hypertension. 2013;61(3):635–640. doi: 10.1161/HYPERTENSIONAHA.111.00566. [PubMed] [CrossRef] [Google Scholar]
15. Kopp C, et al. (23)Na magnetic resonance imaging of tissue sodium. Hypertension. 2012;59(1):167–172. doi: 10.1161/HYPERTENSIONAHA.111.183517. [PubMed] [CrossRef] [Google Scholar]
16. Machnik A, et al. Macrophages regulate salt-dependent volume and blood pressure by a vascular endothelial growth factor-C-dependent buffering mechanism. Nat Med. 2009;15(5):545–552. doi: 10.1038/nm.1960. [PubMed] [CrossRef] [Google Scholar]
17. Wiig H, et al. Immune cells control skin lymphatic electrolyte homeostasis and blood pressure. J Clin Invest. 2013;123(7):2803–2815. doi: 10.1172/JCI60113. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
18. Jantsch J, et al. Cutaneous Na+ storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense. Cell Metab. 2015;21(3):493–501. doi: 10.1016/j.cmet.2015.02.003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
19. Szabo G, Magyar Z. Electrolyte concentrations in subcutaneous tissue fluid and lymph. Lymphology. 1982;15(4):174–177. [PubMed] [Google Scholar]
20. Titze J, et al. Glycosaminoglycan polymerization may enable osmotically inactive Na+ storage in the skin. Am J Physiol Heart Circ Physiol. 2004;287(1):H203–H208. doi: 10.1152/ajpheart.01237.2003. [PubMed] [CrossRef] [Google Scholar]
21. Go WY, Liu X, Roti MA, Liu F, Ho SN. NFAT5/TonEBP mutant mice define osmotic stress as a critical feature of the lymphoid microenvironment. Proc Natl Acad Sci U S A. 2004;101(29):10673–10678. doi: 10.1073/pnas.0403139101. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
22. Kleinewietfeld M, et al. Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells. Nature. 2013;496(7446):518–522. doi: 10.1038/nature11868. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
23. Muller S, et al. Salt-dependent chemotaxis of macrophages. PLoS One. 2013;8(9): doi: 10.1371/journal.pone.0073439. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
24. Wu C, et al. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1. Nature. 2013;496(7446):513–517. doi: 10.1038/nature11984. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
25. Xue J, et al. Transcriptome-based network analysis reveals a spectrum model of human macrophage activation. Immunity. 2014;40(2):274–288. doi: 10.1016/j.immuni.2014.01.006. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
26. Murray PJ, et al. Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity. 2014;41(1):14–20. doi: 10.1016/j.immuni.2014.06.008. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
27. Mosser DM, Edwards JP. Exploring the full spectrum of macrophage activation. Nat Rev Immunol. 2008;8(12):958–969. doi: 10.1038/nri2448. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
28. Parsa R, et al. Adoptive transfer of immunomodulatory M2 macrophages prevents type 1 diabetes in NOD mice. Diabetes. 2012;61(11):2881–2892. doi: 10.2337/db11-1635. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
29. Jiang HR, et al. IL-33 attenuates EAE by suppressing IL-17 and IFN-γ production and inducing alternatively activated macrophages. Eur J Immunol. 2012;42(7):1804–1814. doi: 10.1002/eji.201141947. [PubMed] [CrossRef] [Google Scholar]
30. Mikita J, et al. Altered M1/M2 activation patterns of monocytes in severe relapsing experimental rat model of multiple sclerosis. Mult Scler. 2011;17(1):2–15. doi: 10.1177/1352458510379243. [PubMed] [CrossRef] [Google Scholar]
31. Szanto A, et al. STAT6 transcription factor is a facilitator of the nuclear receptor PPARγ-regulated gene expression in macrophages and dendritic cells. Immunity. 2010;33(5):699–712. doi: 10.1016/j.immuni.2010.11.009. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
32. Huber S, Hoffmann R, Muskens F, Voehringer D. Alternatively activated macrophages inhibit T-cell proliferation by Stat6-dependent expression of PD-L2. Blood. 2010;116(17):3311–3320. doi: 10.1182/blood-2010-02-271981. [PubMed] [CrossRef] [Google Scholar]
33. Bouhlel MA, et al. PPARγ activation primes human monocytes into alternative M2 macrophages with anti-inflammatory properties. Cell Metab. 2007;6(2):137–143. doi: 10.1016/j.cmet.2007.06.010. [PubMed] [CrossRef] [Google Scholar]
34. Odegaard JI, et al. Macrophage-specific PPARγ controls alternative activation and improves insulin resistance. Nature. 2007;447(7148):1116–1120. doi: 10.1038/nature05894. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
35. Haschemi A, et al. The sedoheptulose kinase CARKL directs macrophage polarization through control of glucose metabolism. Cell Metab. 2012;15(6):813–826. doi: 10.1016/j.cmet.2012.04.023. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
36. Huang SC, et al. Cell-intrinsic lysosomal lipolysis is essential for alternative activation of macrophages. Nat Immunol. 2014;15(9):846–855. doi: 10.1038/ni.2956. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
37. Byles V, et al. The TSC-mTOR pathway regulates macrophage polarization. Nat Commun. 2013;4: [PMC free article] [PubMed] [Google Scholar]
38. Lumeng CN, Bodzin JL, Saltiel AR. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest. 2007;117(1):175–184. doi: 10.1172/JCI29881. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
39. Li L, et al. Role of myeloid-derived suppressor cells in glucocorticoid-mediated amelioration of FSGS. J Am Soc Nephrol. 2015;26(9):2183–2197. doi: 10.1681/ASN.2014050468. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
40. Marigo I, et al. Tumor-induced tolerance and immune suppression depend on the C/EBPβ transcription factor. Immunity. 2010;32(6):790–802. doi: 10.1016/j.immuni.2010.05.010. [PubMed] [CrossRef] [Google Scholar]
41. Reese TA, et al. Chitin induces accumulation in tissue of innate immune cells associated with allergy. Nature. 2007;447(7140):92–96. doi: 10.1038/nature05746. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
42. Satoh T, et al. The Jmjd3-Irf4 axis regulates M2 macrophage polarization and host responses against helminth infection. Nat Immunol. 2010;11(10):936–944. doi: 10.1038/ni.1920. [PubMed] [CrossRef] [Google Scholar]
43. Martin P. Wound healing--aiming for perfect skin regeneration. Science. 1997;276(5309):75–81. doi: 10.1126/science.276.5309.75. [PubMed] [CrossRef] [Google Scholar]
44. Singer AJ, Clark RA. Cutaneous wound healing. N Engl J Med. 1999;341(10):738–746. doi: 10.1056/NEJM199909023411006. [PubMed] [CrossRef] [Google Scholar]
45. Deonarine K, et al. Gene expression profiling of cutaneous wound healing. J Transl Med. 2007;5: [PMC free article] [PubMed] [Google Scholar]
46. Martin P, et al. Wound healing in the PU. Curr Biol. 2003;13(13):1122–1128. doi: 10.1016/S0960-9822(03)00396-8. [PubMed] [CrossRef] [Google Scholar]
47. Liao X, et al. Kruppel-like factor 4 regulates macrophage polarization. J Clin Invest. 2011;121(7):2736–2749. doi: 10.1172/JCI45444. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
48. Heikamp EB, et al. The AGC kinase SGK1 regulates TH1 and TH2 differentiation downstream of the mTORC2 complex. Nat Immunol. 2014;15(5):457–464. doi: 10.1038/ni.2867. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
49. Lang F. Effect of cell hydration on metabolism. Nestle Nutr Inst Workshop Ser. 2011;69:115–126. [PubMed] [Google Scholar]
50. Pearce EL, Poffenberger MC, Chang CH, Jones RG. Fueling immunity: insights into metabolism and lymphocyte function. Science. 2013;342(6155): doi: 10.1126/science.1242454. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
51. O’Sullivan D, et al. Memory CD8(+) T cells use cell-intrinsic lipolysis to support the metabolic programming necessary for development. Immunity. 2014;41(1):75–88. doi: 10.1016/j.immuni.2014.06.005. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
52. van der Windt GJ, et al. CD8 memory T cells have a bioenergetic advantage that underlies their rapid recall ability. Proc Natl Acad Sci U S A. 2013;110(35):14336–14341. doi: 10.1073/pnas.1221740110. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
53. Man K, et al. The transcription factor IRF4 is essential for TCR affinity-mediated metabolic programming and clonal expansion of T cells. Nat Immunol. 2013;14(11):1155–1165. doi: 10.1038/ni.2710. [PubMed] [CrossRef] [Google Scholar]
54. Everts B, et al. TLR-driven early glycolytic reprogramming via the kinases TBK1-IKKvarε supports the anabolic demands of dendritic cell activation. Nat Immunol. 2014;15(4):323–332. doi: 10.1038/ni.2833. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
55. Everts B, et al. Commitment to glycolysis sustains survival of NO-producing inflammatory dendritic cells. Blood. 2012;120(7):1422–1431. doi: 10.1182/blood-2012-03-419747. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
56. Zarubin T, Han J. Activation and signaling of the p38 MAP kinase pathway. Cell Res. 2005;15(1):11–18. doi: 10.1038/sj.cr.7290257. [PubMed] [CrossRef] [Google Scholar]
57. Ip WK, Medzhitov R. Macrophages monitor tissue osmolarity and induce inflammatory response through NLRP3 and NLRC4 inflammasome activation. Nat Commun. 2015;6:6931. [PMC free article] [PubMed] [Google Scholar]
58. Chang CH, et al. Posttranscriptional control of T cell effector function by aerobic glycolysis. Cell. 2013;153(6):1239–1251. doi: 10.1016/j.cell.2013.05.016. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
59. Colegio OR, et al. Functional polarization of tumour-associated macrophages by tumour-derived lactic acid. Nature. 2014;513(7519):559–563. doi: 10.1038/nature13490. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
60. Tannahill GM, et al. Succinate is an inflammatory signal that induces IL-1β through HIF-1α Nature. 2013;496(7444):238–242. doi: 10.1038/nature11986. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
61. Shi LZ, et al. HIF1α-dependent glycolytic pathway orchestrates a metabolic checkpoint for the differentiation of TH17 and Treg cells. J Exp Med. 2011;208(7):1367–1376. doi: 10.1084/jem.20110278. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
62. Ganeshan K, Chawla A. Metabolic regulation of immune responses. Annu Rev Immunol. 2014;32:609–634. doi: 10.1146/annurev-immunol-032713-120236. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
63. Wulff P, et al. Impaired renal Na(+) retention in the sgk1-knockout mouse. J Clin Invest. 2002;110(9):1263–1268. doi: 10.1172/JCI15696. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
64. Kueper C, Beck FX, Neuhofer W. Generation of a conditional knockout allele for the NFAT5 gene in mice. Front Physiol. 2015;5:507. [PMC free article] [PubMed] [Google Scholar]

reduced wound healing.

 

[Tristan Loscha]

Curr Opin Nephrol Hypertens. Author manuscript; available in PMC 2017 May 16.
Published in final edited form as:
Curr Opin Nephrol Hypertens. 2016 Jan; 25(1): 11–15.
doi: 10.1097/MNH.0000000000000188
PMCID: PMC5432654
NIHMSID: NIHMS747527
PMID: 26625865
Cutaneous control of blood pressure
Randall S Johnson,a Jens Titze,b,c and Richard Wellerd
Author information Copyright and License information Disclaimer
The publisher's final edited version of this article is available at Curr Opin Nephrol Hypertens
See other articles in PMC that cite the published article.
Go to:
Abstract
Purpose of review
Textbook theory holds that blood pressure is regulated by the brain, by blood vessels, or by the kidney. Recent evidence suggests that blood pressure could be regulated in the skin.

Recent findings
The skin holds a complex capillary counter current system which controls body temperature, skin perfusion, and apparently systemic blood pressure. Epidemiological data suggest that sunlight exposure plays a role in controlling blood pressure. UVA radiation produces vasodilation and a fall in blood pressure. Keratinocytes and immune cells control blood flow in the extensive countercurrent loop system of the skin by producing NO, a key regulator of vascular tone. The balance between HIF-1α and HIF-2α activity in keratinocytes controls skin perfusion, systemic thermoregulation, and systemic blood pressure by NO-dependent mechanisms. Furthermore, the skin accumulates Na+ which generates a barrier to promote immunological host defense. Immune cells control skin Na+ metabolism and the clearance of Na+ via the lymphatic system. Reduced lymphatic clearance increases blood pressure.

Summary
Besides the well-known role of the brain, blood vessels, and the kidney, the skin is important for systemic blood pressure control in humans and in experimental animals.

Keywords: hypertension, skin, keratinocytes, nitric oxide, hypoxia inducible factor, sodium, lymph vessels

 

[Tristan Loscha]

Macrophages regulate salt-dependent volume and blood pressure by a vascular endothelial growth factor-C-dependent buffering mechanism
Agnes Machnik 1 , Wolfgang Neuhofer, Jonathan Jantsch, Anke Dahlmann, Tuomas Tammela, Katharina Machura, Joon-Keun Park, Franz-Xaver Beck, Dominik N Müller, Wolfgang Derer, Jennifer Goss, Agata Ziomber, Peter Dietsch, Hubertus Wagner, Nico van Rooijen, Armin Kurtz, Karl F Hilgers, Kari Alitalo, Kai-Uwe Eckardt, Friedrich C Luft, Dontscho Kerjaschki, Jens Titze
Affiliations

• PMID: 19412173
• DOI: 10.1038/nm.1960

Abstract
In salt-sensitive hypertension, the accumulation of Na(+) in tissue has been presumed to be accompanied by a commensurate retention of water to maintain the isotonicity of body fluids. We show here that a high-salt diet (HSD) in rats leads to interstitial hypertonic Na(+) accumulation in skin, resulting in increased density and hyperplasia of the lymphcapillary network. The mechanisms underlying these effects on lymphatics involve activation of tonicity-responsive enhancer binding protein (TonEBP) in mononuclear phagocyte system (MPS) cells infiltrating the interstitium of the skin. TonEBP binds the promoter of the gene encoding vascular endothelial growth factor-C (VEGF-C, encoded by Vegfc) and causes VEGF-C secretion by macrophages. MPS cell depletion or VEGF-C trapping by soluble VEGF receptor-3 blocks VEGF-C signaling, augments interstitial hypertonic volume retention, decreases endothelial nitric oxide synthase expression and elevates blood pressure in response to HSD. Our data show that TonEBP-VEGF-C signaling in MPS cells is a major determinant of extracellular volume and blood pressure homeostasis and identify VEGFC as an osmosensitive, hypertonicity-driven gene intimately involved in salt-induced hypertension.

 

[Tristan Loscha]

Pediatric Nephrology (Berlin, Germany)
Pediatr Nephrol. 2017; 32(2): 201–210.
Published online 2016 Feb 26. doi: 10.1007/s00467-016-3349-x
PMCID: PMC5203836
PMID: 26921211
Elementary immunology: Na+ as a regulator of immunity
Valentin Schatz,1 Patrick Neubert,1 Agnes Schröder,2 Katrina Binger,3 Matthias Gebhard,4,5 Dominik N. Müller,4,5 Friedrich C. Luft,4,5,6 Jens Titze,2,6 and Jonathan Jantsch

1
Author information Article notes Copyright and License information Disclaimer
This article has been cited by other articles in PMC.
Go to:
Abstract
The skin can serve as an interstitial Na+ reservoir. Local tissue Na+ accumulation increases with age, inflammation and infection. This increased local Na+ availability favors pro-inflammatory immune cell function and dampens their anti-inflammatory capacity. In this review, we summarize available data on how NaCl affects various immune cells. We particularly focus on how salt promotes pro-inflammatory macrophage and T cell function and simultaneously curtails their regulatory and anti-inflammatory potential. Overall, these findings demonstrate that local Na+ availability is a promising novel regulator of immunity. Hence, the modulation of tissue Na+ levels bears broad therapeutic potential: increasing local Na+ availability may help in treating infections, while lowering tissue Na+ levels may be used to treat, for example, autoimmune and cardiovascular diseases.

Keywords: Local Na+ availability, Skin salt storage, Macrophages, T cells, Immune cell function and activation
Go to:
Introduction
In general, all extracellular body fluids are thought to readily equilibrate and display osmolalities similar to those of plasma. Traditionally, local salt storage in tissues was not considered to occur; consequently, studying local salt composition and its effect on tissues other than the kidney has been largely disregarded, although evidence to that effect already existed in 1909 [1, 2]. The generally accepted exception to this rule is of course the kidney, where large differences in electrolyte concentration are present and also required for the production of concentrated urine. For example, in the inner medulla of kidney osmolalities up to 1200 mOsm/kg can be achieved (reviewed in [3]). These increased electrolyte levels and osmolalities in this part of the kidney might especially have an impact on the biology of mononuclear phagocytes because these immune cells are known to be present in high numbers in the interstitium of the renal medulla [4, 5].

Mononuclear phagocytes consist of macrophages, monocytes and dendritic cells (reviewed in [6–8]) which play key roles in host defense due to their innate antimicrobial activity and their ability to mount and regulate adaptive immune responses (reviewed in [9–11]). However, in addition to these classical functions mononuclear phagocytes are able to adopt a regulatory phenotype that eventually leads to the resolution of inflammation and tissue repair (reviewed in [10, 12, 13]). Moreover, these versatile cells can adapt to various local tissue microenvironments and change their function according to the required needs (reviewed in [10, 12, 14, 15]). For example, tissue-derived retinoic acid polarizes peritoneal macrophages through the induction of GATA-binding factor 6 (GATA6) to support the immunoglobulin A (IgA) production of peritoneal B-1 cells which in turn play a pivotal role in early defense against pathogens [16]. Macrophages do not only protect against invading intruders, but they are also key players in orchestrating the resolution of the infection, and they have a critical function in the response to sterile ischemic insults. More specifically, in myocardial infarction, macrophages play a key role in tissue repair as well as in the activation and mobilization of stem cells (reviewed in [17]). In addition, macrophages serve as angiogenic and arteriogenic accessory cells [18–20] and thereby assist in ensuring sufficient tissue oxygenation. They are also able to support lipid handling [21, 22] and to mitigate obesity-associated inflammation [23]. These cells even orchestrate the development of brown fat and promote thermogenesis [24–26]. Therefore, it is not surprising that mononuclear phagocytes are also perfectly suited to survive and to fulfill important tasks within the very hypertonic microenvironments of the kidney.

Go to:
Salt gradients in the kidney and their impact on mononuclear phagocytes
Electrolyte concentrations found in the medullary environment of the kidney impact on the immunobiology of the renal mononuclear cell network and augment their arginase-1 (Arg1) expression, which produces urea from L-arginine [27]. Enhanced Arg1 expression of these medullary mononuclear phagocytes is linked with an anti-inflammatory phenotype [27]. This mirrors earlier findings that, in contrast to their cortical counterparts, medullary mononuclear phagocytes are weak stimulators of inflammatory T cell responses in a mouse model of crescentic glomerulonephritis [28]. Therefore, it is tempting to speculate that instead of supporting inflammatory reactions, the main function of interstitial medullary mononuclear myeloid cells is to help in the local buildup of urea solutes by breaking down L-arginine. Thereby, medullary mononuclear phagocytes might support the production of concentrated urine. In line with this notion there are two recent publications showing that these interstitial mononuclear cells indeed serve as accessory cells in the kidney’s task to handle electrolytes. Harris and coworkers demonstrated that high salt diets increase the expression of cyclooxygenase-2 in renal mononuclear phagocytes and that this renal mononuclear phagocyte-driven prostaglandin production decreased the phosphorylation and activity of the renal Na+–Cl− cotransporter in the distal convoluted tubule in the renal cortex [29]. Using a mouse model of renin angiotensin system (RAS)-mediated hypertension, Crowley and coworkers discovered that interleukin (IL)-1 receptor signaling impairs the ability of intra-renal macrophages to facilitate tubular Na+ excretion [30]. Excess aldosterone [31] as well as the treatment of uninephrectomized mice with deoxycorticosterone acetate and saline to drink [32] result in overproduction of IL-1β and thereby might impact on renal Na+ handling. Together, these data suggest that RAS blockade might promote the macrophage’s accessory function of assisting tubular Na+ excretion in addition to its ability to block inflammation and fibrosis (reviewed in [33]).

Increased NaCl concentration not only modulates this homoeostatic accessory function of renal mononuclear phagocytes, it also promotes the release of inflammatory cytokines and chemokines. Studies have shown that increases in the NaCl concentration to osmolalities of approximately 500–630 mOsm/kg were sufficient to promote the release of tumor necrosis factor (TNF) [34, 35] and chemokine (C-X-C motif) ligand 2 (CXCL2; macrophage inflammatory protein-2) [34] from macrophages in the absence of any additional inflammatory priming. Ip and Medzhitov reported that an increase in the NaCl concentration by 100 mM to a total osmolality of approximately 500 mOsm/kg in lipopolysaccharide (LPS)-treated cells promoted caspase-1-dependent IL-1β- and IL-1α-release from macrophages [36], while an increase of 40 mM NaCl compared to standard cell culture conditions alone were not sufficient to promote the release of IL-1 in LPS-treated cells [37]. Mechanistically, very high salt concentrations promote the production of mitochondrial reactive oxygen species (ROS) and thereby trigger subsequent inflammasome activation [36]. Given that monosodium urate-mediated Na+ overload is known to trigger inflammasome activation and concomitant Na+ loading of macrophages [38, 39], high salt conditions might further boost the induction of urate-mediated inflammasome activation and, in general, impact on the clinical course of crystal-associated kidney diseases (reviewed in [40, 41]).

Go to:
Local salt storage in the skin of mice and men
In contrast to the prevailing notion that the kidney is the sole organ wherein electrolyte gradients can occur, there are several lines of evidence indicating that electrolyte handling in the body is much more complex than previously believed and that electrolyte gradients can occur in organs other than the kidney (reviewed in [42, 43]). Over 100 years ago, Wahlgren and Padtberg noted that following increased dietary salt intervention the skin can serve as a salt depository [1, 2]. Approximately 40 years ago, Ivanova et al. reported that huge amounts of Na+ can be stored in the skin and linked to an enhanced sulfation of glycosaminoglycans in rats, which might serve as a negative charge capacitor for Na+ [44]. A few years later, Szabo and Magyar reported that in rabbits, Na+ and K+ concentrations were higher in tissue fluids than in the serum [45]. This phenomenon has more recently also been shown in mice, where salt was found to accumulate in the skin upon a high salt diet while plasma electrolyte levels remained unchanged [46, 47].

These findings suggest that in addition to the kidney, other regulatory circuits must exist that govern electrolyte balances within tissues. We postulate that the glycosaminoglycan storage depots lead to microenvironmental domains, such that the interstitial Na+ concentration is substantially higher than that recorded in the plasma. While the mechanisms that drive dietary Na+ deposition in the skin remain elusive, it is known that the clearance of electrolytes from the skin is regulated by macrophages. A high NaCl concentration serves as a chemotactic stimulus for macrophages [48], and upon high dietary salt intake, macrophages infiltrate the skin and induce on-site vascular endothelial growth factor (VEGF)-C production [46, 49]. VEGF-C production in macrophages is directly governed by the osmoprotective transcription factor tonicity-dependent enhancer binding protein/nuclear factor of activated T cells 5 (TonEBP/NFAT5). Enhanced VEGF-C tissue levels are required to induce lymphatic hyperplasia by stimulating VEGF receptor 3 (VEGFR3) signaling [47]. This lymphatic hyperplasia is necessary for electrolyte drainage. By disturbing macrophage infiltration in the skin, VEGF-C signaling or NFAT5 signaling in macrophages interferes with the clearance of electrolytes in tissues and results in increased blood pressure [46, 49]. In line with this notion, mice displaying enhanced lymphatic vessel density display enhanced fluid drainage from peripheral tissues and are hypotensive [50]. Moreover, cyclooxygenase-2 in macrophages plays an important role in supporting macrophage-driven VEGF-C secretion and lymphangiogenesis and thereby contributes to abating salt-sensitive arterial hypertension [29].

23Na-Magnetic resonance imaging (MRI) technology allows for non-invasive visualization and the quantification of tissue Na+ stores in humans [51]. This novel technology was used to assess Na+ stores in various cardiovascular and kidney diseases. Primary and secondary hypertension are both linked with increases in skin Na+ levels [51, 52]. Hammon et al. reported that patients suffering from acute heart failure also displayed enhanced skin and skeletal muscle Na+ storage [53]. This was not followed by concomitant swelling of the muscle tissue, indicating osmotically inactive cellular Na+ storage. Upon diuretic treatment, this tissue Na+ accumulation was at least partially reversible [53]. This observation documents that Na+ storage is reversible and exchangeable.

Skin and muscle Na+ overload was also evident in hemodialysis patients and can be mobilized by dialysis treatment. However, the mobilization of tissue Na+ is impaired in older patients and patients with low VEGF-C levels [54]. Once more, this observation further underpins the concept that local regulatory circuits play an important role in tissue electrolyte balance. In this context it is tempting to speculate that increased skin Na+ storage in the elderly [55] might be related to a decrease in lymphatic vessel density and function during the ageing process [56]. Whether or not this age-dependent decline of lymphatic function is linked to decreased VEGF-C-levels or inhibitors of VEGF-C signaling, such as soluble VEGF-C receptors, is unknown. We further speculate that the reduced density and function of lymphatics in the elderly might impair local clearance of electrolytes from tissues and contribute to arterial hypertension.

Go to:
Skin salt storage upon infection
Local salt storage is not solely a feature of cardiovascular and kidney diseases. We recently observed that there is an unusually high amount of Na+ accumulation, without commensurate water retention, in the infected skin of mice bitten by cage mates and kept on a constant low salt diet [57]. Chemical analyses of the areas of infected skin demonstrated an effective total osmolyte-to-skin water ratio that was approximately 40 mM higher than concentrations in the plasma. This level resembled approximately the increase of effective osmolytes observed in mice kept on an experimental high salt diet (4 % NaCl in chow, 0.9 % NaCl in water) and suggested that the interstitial microenvironment of the infected skin is hypertonic [57]. However, the amount of effective osmolytes found in inflamed skin was considerably lower than that of the osmolytes found in the kidney medulla. In line with our findings, Schwartz et al. demonstrated that subcutaneous injection of Bacille Calmette–Guérin or Freund’s adjuvant resulted in enhanced tissue osmolalities [58]. Na+ accumulation in infected/inflamed tissue is not only evident in rodents, but also occurs in humans. In three studies, 23Na-MRI technology was used to quantify Na+ levels in inflamed and infected tissues in patients with multiple sclerosis (MS) and superficial streptococcal skin infections, respectively. These analyses revealed that Na+ is stored in inflammatory MS lesions [59, 60] and infected skin tissue [57]. Antibiotic treatment of the superficial skin infection resulted in a reduction of skin tissue Na+ levels [57]. These data indicate that infection/inflammation drives local salt accumulation. The regulatory circuits that drive salt accumulation upon the site of infection and/or inflammation are, however, unknown.

Go to:
A high salt level augments pro-inflammatory and antimicrobial macrophage function
We were excited by the notion that enhanced salt concentrations found at the site of infection (approx. 40 mM increase in effective osmolytes compared to plasma) might be an unappreciated beneficial strategy to ward off infections by boosting the immune system and its antimicrobial activity. Several lines of evidence support this possibility. First, changes in tissue osmolalities in zebrafish activate innate immune responses and mediate rapid wound closure and tissue repair [61–63]. Therefore, changes in tissue osmolality might represent an ancient danger signal which is advantageous because it does not require the de novo production of mediators and thereby ensures immediate delivery of the signal. Second, increases of 40 mM in effective osmolytes to a final osmolality of 380 mOsm/kg are unlikely to induce a direct effect on pathogen survival given that Escherichia coli can very well tolerate osmolalities of 400 mOsm/ kg [64]. Third, p38/mitogen-activated protein kinase (MAPK) and TonEBP/NFAT5 are both induced by NaCl-mediated osmotic stress and by stimulation with the pro-inflammatory bacterial cell-wall component LPS [65–67]. These observations already imply that osmoprotective and inflammatory responses might be intertwined. Also, exposure of peripheral blood mononuclear cells to increased levels of NaCl (+40 mM NaCl compared to standard cell culture conditions) enhanced the release of IL-8 in a p38/MAPK-dependent manner [68], while decreasing the osmolality below standard cell culture conditions impaired IL-8 release [69]. Similarly, increasing NaCl concentrations in cell culture media augmented inflammatory cytokine release of LPS-stimulated human peripheral blood mononuclear cells and human monocytic THP-1 cells [69–71]. Finally, the tonicity-dependent interaction between NFAT5 and nuclear factor (NF)-κB p65 subunits show a considerably enhanced nuclear factor(NF)-κB activity following the binding of NF-κB–NFAT5 complexes to κB elements of NF-κB-responsive genes [72]. After taking all these points into consideration, we hypothesized that high salt conditions do not exert a direct antimicrobial activity—rather they boost the host’s immunity and eventually help in clearing infections.

Indeed, when we performed experiments to examine this hypothesis in more detail, we observed that the inflammatory activation of macrophages stimulated with LPS in the presence of high NaCl concentrations equivalent to what had been seen in the infected skin of rodents (an increase of 40 mM NaCl) was augmented [57]. This high salt response included a marked increase in TNF release and type-2 nitric oxide (NO) synthase (Nos2)-dependent NO production, suggesting enhanced classical macrophage activation [57]. These findings were subsequently confirmed by independent research groups [73, 74]. Moreover, this enhanced pro-inflammatory activation is also present in retina pigment epithelium cells [75]. Mechanistically, high salt-boosted macrophage activation required p38/MAPK and downstream NFAT5-signaling, but it was independent of signal transducer and activator of transcription (STAT) 1-signal transduction [57]. Furthermore, this activation subsequently resulted in modified epigenetic markers. Of note, increasing the NaCl concentration by 40 mM compared to standard cell culture NaCl concentrations in the absence of LPS (i.e. NaCl alone) did not favor significant pro-inflammatory cytokine and mediator release on its own [57].

In our study [57], increasing salt availability (+40 mM NaCl compared to standard cell culture media) not only promoted macrophage activation, but it also improved antimicrobial control. High salt conditions in the absence of macrophages (+40 mM NaCl compared to standard cell culture media) did not impair growth of the pathogens, thus excluding a direct antimicrobial effect of high salt alone. Using a Leishmania major infection model, we demonstrated that boosting the anti-leishmanial activity of macrophages also required p38α/MAPK–NFAT5 signaling and subsequent Nos2-dependent production of leishmanicidal NO. Increasing skin Na+ stores by high salt diets subsequently improved cutaneous anti-leishmanial control in mice. This process required NFAT5-dependent signaling in macrophages [57]. These findings demonstrate that increases in local Na+ content in the skin can act in concert with tissue damage/infection as a danger signal, which in turn enhances innate immune cell activation and helps in warding off macrophage-prone skin infections.

In contrast to favoring classical pro-inflammatory macrophage activation, high salt conditions (+40 mM NaCl compared to standard cell culture media) has been found to impair the development and functionality of IL-4- and IL-4/IL-13-driven alternative macrophage activation, which is required for tissue repair and the resolution of inflammation [73, 74, 76]. The high salt-mediated blockade of alternative macrophage activation was shown to hinge on the impairment of the ‘serine/threonine-protein kinase AKT’ and ‘mechanistic target of Rapamycin’ (mTOR) pathway, but was independent of STAT 6-signal transduction [76]. This resulted in an impaired ability of alternative activated macrophages to suppress T cell proliferation and mediate wound healing [76]. Altogether, these findings are complementary to those with pro-inflammatory classical macrophages [57], as they demonstrate that enhanced Na+ levels can act as a danger signal which promotes the skewing of macrophages away from an anti-inflammatory immune cell phenotype and towards a pro-inflammatory macrophage phenotype and subsequent antimicrobial control (Fig. 1).

Fig. 1
Effects of a high salt level on macrophage immunobiology. COX-2 Cyclooxygenase-2, NO nitric oxide, Nos2 type-2 NO synthase, TNF tumor necrosis factor, VEGF vascular endothelial growth factor

Go to:
High salt promotes inflammatory T cell activation
Salt-induced enhancement of leukocyte function are not confined to macrophages that belong to the innate immune system, but they operate in T cells which form an essential part of the antigen-specific adaptive immune system and whose function is known to be governed by various microenvironmental cues [77]. For almost two decades it has been known that increasing NaCl conditions by approximately 40 mM boosts IL-2 expression and T cell proliferation [70, 78]. Again, this increased Na+ concentration mimics the levels of effective skin osmolytes observed under conditions of high salt diets and infection/inflammation, and promotes p38/MAPK signaling in T cells [79, 80]. Moreover, Loomis et al. reported that high salt conditions (+40 mM NaCl) restored IL-2 production of T cells that had been suppressed by IL-4, IL-10, transforming growth factor and prostaglandin E2 [81]. This observation suggests that increased tonicity, which is present in secondary lymphatic organs [82], favors T cell proliferation. In line with this notion, mice haplodeficient for the central osmostress transcription factor Nfat5 displayed reduced splenocyte proliferation, impaired IgG responses after vaccination [82] and impaired cytokine production by T cells [83]. This further substantiates that high salt-induced pathways play an important role in T cell immunology.

However Na+ does not only favor T cell proliferation in general, but it also affects the activation/polarization of T cells. T cells differentiate into cytotoxic, helper and regulatory T cells. While the knowledge of the effect of high salt on cytotoxic T cell functions is very sparse, a substantial body of information is now available on how salt affects the helper and regulatory T cell functions. High salt conditions specifically boost the development of IL-17-producing CD4+ T helper cells (Th17), which are known to provide protection from infectious diseases and to worsen autoimmune diseases, such as MS [84, 85]. Mechanistically, high salt promotes the activation of Th17 cells, once again via p38/MAPK and NFAT5 [85], as well as serum/glucocorticoid-regulated kinase 1 (SGK1)-dependent signaling [84, 85]. In a mouse model of MS, high salt diets were shown to be linked to increased Th17 cell infiltration into the central nervous system and aggravated clinical outcome [84, 85]. In contrast, high salt levels have been shown to impair the functionality and development of regulatory forkhead box P3 (Foxp3)+ T cells (Tregs), which play a key role in self-tolerance and are dysregulated in autoimmune diseases [86, 87]. Mechanistically, this again required SGK1-signaling. High salt-induced SGK1-signal transduction has been shown to promote interferon release from Tregs, which abrogated their suppressive effects [87]. This high salt-inhibited Treg function aggravated the clinical course in a mouse model of graft versus host disease [87]. In line with the notion that high salt induces the impairment of Treg function, high salt diets accelerated allograft rejection in a mouse model, which were paralleled by a reduced frequency of Tregs [86]. Again, this was dependent on SGK1 signaling in CD4+ T cells [86]. Downstream of SGK1, impaired forkhead box O3 (FoxO) 1/3a signal transduction might affect the accessibility of Foxp3 to its transcriptional binding sites [87] and/or the regulation of Foxp3 expression [86]. Taken together, these studies indicate that high salt levels have differential effects on T cell activation; further studies are required to determine whether high salt conditions also impact on other T helper cell subsets.

Importantly, while high salt diets affect Th17 and Treg activation in these preclinical models, the precise location where T cells face high salt conditions in vivo is as yet unknown. Again, T cells could encounter very salty conditions in the medulla of the kidney [88]. Other possibilities could be when T cells patrol through Na+-laden skin or, alternatively, high salt diets may augment Na+ levels in secondary lymphatic organs where T cell activation and proliferation take place. Moreover, it is possible that in vivo in addition to directly affecting T cell activation, high salt diets impact on antigen-presenting cells, such as macrophages/ dendritic cells, as well as on the ability of these cells to regulate T cell immunity, such as Th17 proliferation. In line with this notion, a recent study has demonstrated that high salt conditions favored an antigen-independent boost of T cell proliferation by enhancing pro-inflammatory macrophage activation [74]. Taken together, the available data suggest that high salt conditions favor T cell proliferation and skewing of these cells to a pro-inflammatory phenotype, while concomitantly impairing the tolerogenic functions of these cells (Fig. 2).

Fig. 2
Effects of a high salt level on T cell immunobiology. Fox01/3a Forkhead box O3 1/3a, IL-2 interleukin-2, NFAT5 nuclear factor of activated T cells, p38/MAPK p38/mitogen-activated protein kinase, SGK1 serum/glucocorticoid-regulated kinase 1

Go to:
Salt and other immune cells
Little information is available on other immune cells and the effect of high salt levels on their function and activation. For example, the impact of salt on the immunobiology of B cells is very limited, although it is known that in addition to producing antibodies, these cells are able to phagocytose and present antigens, as well as to fulfill important regulatory functions (reviewed in [89, 90]). To the best of our knowledge, only one report has described a role for salt-signaling molecules in B cell function: this study focuses on a guanine nucleotide exchange factor, Brx [91]. The authors demonstrate that this molecule is essential for the expression of Nfat5 in response to osmotic stress, thus transmitting the extracellular hyperosmolarity signal and enabling differentiation of splenic B cells and production of immunoglobulins [91].

In addition to some studies on B cells, there are some reports on the effect of high salt levels on granulocytes. These innate immune cells are a key component of the immediate antimicrobial innate host response. The activity of NADPH oxidase and of the myeloperoxidase-mediated ROS production are key components of their antimicrobial arsenal (reviewed in [92]). Very high concentrations of 270 mM NaCl, which might occur in the medulla of the kidney, reportedly block ROS accumulation, chemotaxis, phagocytosis and the killing capacity of neutrophils [93–96]. In line with this, it is known that very high salt conditions (as might occur in the medulla of the kidney) impair proteolytic enzymes, such as Cathepsin G [97] and elastases [98]. Increases in Na+ concentration by 40 mM, comparable to levels found in infected or dietary Na+-laden skin, did not interfere with ROS production of N-formyl-methionyl-leucyl-phenylalanine (fMLP)-activated granulocytes and even enhanced the elastase release of fMLP-activated granulocytes [99, 100]. Similarly, enhancing osmolarity with Na+/K+ acetate augmented the release of histamine from basophil granulocytes [101]. Whether increased salt concentrations, as found in infected and inflamed skin tissue, affect the subcellular charge balance of phagosomes is as yet unknown (reviewed in [102]). In addition, it is unclear whether enhancing salt concentrations by 40 mM affects the ROS and subsequent bleach production of infected granulocytes (reviewed in [103]) and ultimately results in enhanced antimicrobial function. NaCl injection was found to promote the infiltration of neutrophils into the peritoneal cavity, which might promote local antimicrobial defense [36]. This process might involve high salt-boosted release of the neutrophil-attracting chemokines CXCL1 and CXCL2 [73]. However, further studies are needed to understand the effect of high salt on antimicrobial granulocyte function.

Go to:
Local Na+ metabolism as a new regulator of immunity
Altogether, there is now substantial evidence that local Na+ content can act in concert with tissue damage/infection as a danger signal, enhancing proinflammatory macrophage and T cell function while dampening anti-inflammatory immune responses. Thereby, hypertonic salty microenvironments serve as a protective element against microbial invaders. Hence, an underlying principle of Na+ metabolism might be to strengthen the barrier function of the skin [57].

However, the mechanisms that drive local salt storage under infectious/inflammatory conditions are unknown and warrant further investigation. A detailed understanding of how tissue Na+ levels are regulated might open new avenues to regulate immunity and bears broad therapeutic potential. Increasing local tissue Na+ levels might help the host to fight intruders by enhancing the antimicrobial armory of immune cells. Interestingly, while promoting antimicrobial defense, increasing skin Na+ stores in L. major-infected mice did not promote tissue immunopathology [57] and therefore lacks an unwanted adverse side effect that usually comes with enhancements of immune-driven antimicrobial defense mechanisms [104]. Therefore, increasing tissue Na+ levels in the clinical context of infectious diseases might be an appropriate adjunctive strategy to fight against such infections by specifically enhancing immune-driven antimicrobial defense mechanisms without inducing an excessive inflammatory reaction that is inappropriate to ward off infection [104].

However, in the absence of microbiological invaders, Na+ storage occurs with dietary salt excess in animals and age in humans [52, 55]. In this context, Na+ storage could lead to the unintended consequence of inappropriate pro-inflammatory immune cell activation, which is supported by the findings of salt-exacerbated autoimmune encephalitis, tumorgenesis and hypertension [52, 55, 74, 84, 85, 105]. Hence, in these cases, a detailed knowledge of the regulatory circuits driving local salt accumulation and salt-dependent immune cell activation might be useful to dampen immune responses. For example, blockade of inflammation-driven salt accumulation might be used to possibly diminish inflammatory responses and thus might be used to treat hypertension, autoimmune diseases and even cancer.

Go to:
Acknowledgments
The Deutsche Forschungsgemeinschaft (DFG; SFB 643 B16) supported J.J. and J.T. J.T. was also supported by the German Ministry for Economics and Technology (50WB1218), the Interdisciplinary Center for Clinical Research (IZKF) Erlangen, and the NIH (RO1 HL118579-01). K.J.B. received an Australian National Health and Medical Research Council C. J. Martin Fellowship (APP1037633). The DFG and the German Center for Cardiovascular Research supported D.N.M. and F.L.

Go to:
Compliance with ethical standards
Go to:
Conflict of interest
The authors declare there are no conflicts of interest.

Go to:
References
1. Wahlgren V. Über die Bedeutung der Gewebe als Chlordepots. Arch. Exp. Pathol. Pharmakol. 1909;61:97–112. doi: 10.1007/BF01841955. [CrossRef] [Google Scholar]
2. Padtberg JH. Über die Bedeutung der Haut als Chlordepot. Arch. Exp. Pathol. Pharmakol. 1909;63:60–79. doi: 10.1007/BF01840852. [CrossRef] [Google Scholar]
3. Kurbel S, Dodig K, Radic R. The osmotic gradient in kidney medulla: a retold story. Adv Physiol Educ. 2002;26:278–281. doi: 10.1152/advan.00037.2001. [PubMed] [CrossRef] [Google Scholar]
4. Kruger T, Benke D, Eitner F, Lang A, Wirtz M, Hamilton-Williams EE, Engel D, Giese B, Muller-Newen G, Floege J, Kurts C. Identification and functional characterization of dendritic cells in the healthy murine kidney and in experimental glomerulonephritis. J Am Soc Nephrol. 2004;15:613–621. doi: 10.1097/01.ASN.0000114553.36258.91. [PubMed] [CrossRef] [Google Scholar]
5. Soos TJ, Sims TN, Barisoni L, Lin K, Littman DR, Dustin ML, Nelson PJ. CX3CR1+ interstitial dendritic cells form a contiguous network throughout the entire kidney. Kidney Int. 2006;70:591–596. doi: 10.1038/sj.ki.5001567. [PubMed] [CrossRef] [Google Scholar]
6. Guilliams M, van de Laar L. A hitchhiker’s guide to myeloid cell subsets: practical implementation of a novel mononuclear phagocyte classification system. Front Immunol. 2015;6:406. doi: 10.3389/fimmu.2015.00406. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
7. Guilliams M, Ginhoux F, Jakubzick C, Naik SH, Onai N, Schraml BU, Segura E, Tussiwand R, Yona S. Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny. Nat Rev Immunol. 2014;14:571–578. doi: 10.1038/nri3712. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
8. Geissmann F, Manz MG, Jung S, Sieweke MH, Merad M, Ley K. Development of monocytes, macrophages, and dendritic cells. Science. 2010;327:656–661. doi: 10.1126/science.1178331. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
9. Iwasaki A, Medzhitov R. Regulation of adaptive immunity by the innate immune system. Science. 2010;327:291–295. doi: 10.1126/science.1183021. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
10. Wynn TA, Chawla A, Pollard JW. Macrophage biology in development, homeostasis and disease. Nature. 2013;496:445–455. doi: 10.1038/nature12034. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
11. Iwasaki A, Medzhitov R. Control of adaptive immunity by the innate immune system. Nat Immunol. 2015;16:343–353. doi: 10.1038/ni.3123. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
12. Sica A, Mantovani A. Macrophage plasticity and polarization: in vivo veritas. J Clin Invest. 2012;122:787–795. doi: 10.1172/JCI59643. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
13. Ginhoux F, Schultze JL, Murray PJ, Ochando J, Biswas SK. New insights into the multidimensional concept of macrophage ontogeny, activation and function. Nat Immunol. 2015;17:34–40. doi: 10.1038/ni.3324. [PubMed] [CrossRef] [Google Scholar]
14. Okabe Y, Medzhitov R. Tissue biology perspective on macrophages. Nat Immunol. 2015;17:9–17. doi: 10.1038/ni.3320. [PubMed] [CrossRef] [Google Scholar]
15. Amit I, Winter DR, Jung S. The role of the local environment and epigenetics in shaping macrophage identity and their effect on tissue homeostasis. Nat Immunol. 2015;17:18–25. doi: 10.1038/ni.3325. [PubMed] [CrossRef] [Google Scholar]
16. Okabe Y, Medzhitov R. Tissue-specific signals control reversible program of localization and functional polarization of macrophages. Cell. 2014;157:832–844. doi: 10.1016/j.cell.2014.04.016. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
17. Pinto AR, Godwin JW, Rosenthal NA. Macrophages in cardiac homeostasis, injury responses and progenitor cell mobilisation. Stem Cell Res. 2014;13:705–714. doi: 10.1016/j.scr.2014.06.004. [PubMed] [CrossRef] [Google Scholar]
18. Avraham-Davidi I, Yona S, Grunewald M, Landsman L, Cochain C, Silvestre JS, Mizrahi H, Faroja M, Strauss-Ayali D, Mack M, Jung S, Keshet E. On-site education of VEGF-recruited monocytes improves their performance as angiogenic and arteriogenic accessory cells. J Exp Med. 2013;210:2611–2625. doi: 10.1084/jem.20120690. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
19. Takeda Y, Costa S, Delamarre E, Roncal C, Leite de Oliveira R, Squadrito ML, Finisguerra V, Deschoemaeker S, Bruyere F, Wenes M, Hamm A, Serneels J, Magat J, Bhattacharyya T, Anisimov A, Jordan BF, Alitalo K, Maxwell P, Gallez B, Zhuang ZW, Saito Y, Simons M, De Palma M, Mazzone M. Macrophage skewing by Phd2 haplodeficiency prevents ischaemia by inducing arteriogenesis. Nature. 2011;479:122–126. doi: 10.1038/nature10507. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
20. Hamm A, Veschini L, Takeda Y, Costa S, Delamarre E, Squadrito ML, Henze AT, Wenes M, Serneels J, Pucci F, Roncal C, Anisimov A, Alitalo K, De Palma M, Mazzone M. PHD2 regulates arteriogenic macrophages through TIE2 signalling. EMBO Mol Med. 2013;5:843–857. doi: 10.1002/emmm.201302695. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
21. Odegaard JI, Ricardo-Gonzalez RR, Goforth MH, Morel CR, Subramanian V, Mukundan L, Red Eagle A, Vats D, Brombacher F, Ferrante AW, Chawla A. Macrophage-specific PPARgamma controls alternative activation and improves insulin resistance. Nature. 2007;447:1116–1120. doi: 10.1038/nature05894. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
22. Xu X, Grijalva A, Skowronski A, van Eijk M, Serlie MJ, Ferrante AW., Jr Obesity activates a program of lysosomal-dependent lipid metabolism in adipose tissue macrophages independently of classic activation. Cell Metab. 2013;18:816–830. doi: 10.1016/j.cmet.2013.11.001. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
23. Mauer J, Chaurasia B, Goldau J, Vogt MC, Ruud J, Nguyen KD, Theurich S, Hausen AC, Schmitz J, Bronneke HS, Estevez E, Allen TL, Mesaros A, Partridge L, Febbraio MA, Chawla A, Wunderlich FT, Bruning JC. Signaling by IL-6 promotes alternative activation of macrophages to limit endotoxemia and obesity-associated resistance to insulin. Nat Immunol. 2014;15:423–430. doi: 10.1038/ni.2865. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
24. Nguyen KD, Qiu Y, Cui X, Goh YP, Mwangi J, David T, Mukundan L, Brombacher F, Locksley RM, Chawla A. Alternatively activated macrophages produce catecholamines to sustain adaptive thermogenesis. Nature. 2011;480:104–108. doi: 10.1038/nature10653. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
25. Qiu Y, Nguyen KD, Odegaard JI, Cui X, Tian X, Locksley RM, Palmiter RD, Chawla A. Eosinophils and type 2 cytokine signaling in macrophages orchestrate development of functional beige fat. Cell. 2014;157:1292–1308. doi: 10.1016/j.cell.2014.03.066. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
26. Hui X, Gu P, Zhang J, Nie T, Pan Y, Wu D, Feng T, Zhong C, Wang Y, Lam KS, Xu A. Adiponectin enhances cold-induced browning of subcutaneous adipose tissue via promoting M2 macrophage proliferation. Cell Metab. 2015;22:279–290. doi: 10.1016/j.cmet.2015.06.004. [PubMed] [CrossRef] [Google Scholar]
27. Chessa F, Mathow D, Wang S, Hielscher T, Atzberger A, Porubsky S, Gretz N, Burgdorf S, Grone HJ, Popovic ZV. The renal microenvironment modifies dendritic cell phenotype. Kidney Int. 2015 [PubMed] [Google Scholar]
28. Hochheiser K, Heuser C, Krause TA, Teteris S, Ilias A, Weisheit C, Hoss F, Tittel AP, Knolle PA, Panzer U, Engel DR, Tharaux PL, Kurts C. Exclusive CX3CR1 dependence of kidney DCs impacts glomerulonephritis progression. J Clin Invest. 2013;123:4242–4254. doi: 10.1172/JCI70143. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
29. Zhang MZ, Yao B, Wang Y, Yang S, Wang S, Fan X, Harris RC. Inhibition of cyclooxygenase-2 in hematopoietic cells results in salt-sensitive hypertension. J Clin Invest. 2015;125:4281–4294. doi: 10.1172/JCI81550. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
30. Zhang J, Rudemiller NP, Patel MB, Karlovich NS, Wu M, McDonough AA, Griffiths R, Sparks MA, Jeffs AD, Crowley SD. Interleukin-1 receptor activation potentiates salt reabsorption in angiotensin II-induced hypertension via the NKCC2 Co-transporter in the nephron. Cell Metab. 2016;23(2):360–368. doi: 10.1016/j.cmet.2015.11.013. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
31. Kadoya H, Satoh M, Sasaki T, Taniguchi S, Takahashi M, Kashihara N. Excess aldosterone is a critical danger signal for inflammasome activation in the development of renal fibrosis in mice. FASEB J. 2015;29:3899–3910. doi: 10.1096/fj.15-271734. [PubMed] [CrossRef] [Google Scholar]
32. Krishnan SM, Sobey CG, Kemp-Harper B, Chan CT, Diep H, Dowling J, Pinai A, Mansell A, Drummond GR. Inflammasome activity is essential for deoxycorticosterone acetate/salt-induced hypertension in mice. Hypertension. 2015;65:E28. [PMC free article] [PubMed] [Google Scholar]
33. Brown NJ. Contribution of aldosterone to cardiovascular and renal inflammation and fibrosis. Nat Rev Nephrol. 2013;9:459–469. doi: 10.1038/nrneph.2013.110. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
34. Kostyk AG, Dahl KM, Wynes MW, Whittaker LA, Weiss DJ, Loi R, Riches DW. Regulation of chemokine expression by NaCl occurs independently of cystic fibrosis transmembrane conductance regulator in macrophages. Am J Pathol. 2006;169:12–20. doi: 10.2353/ajpath.2006.051042. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
35. Lang KS, Fillon S, Schneider D, Rammensee HG, Lang F. Stimulation of TNF alpha expression by hyperosmotic stress. Pflugers Arch. 2002;443:798–803. doi: 10.1007/s00424-001-0768-7. [PubMed] [CrossRef] [Google Scholar]
36. Ip WK, Medzhitov R. Macrophages monitor tissue osmolarity and induce inflammatory response through NLRP3 and NLRC4 inflammasome activation. Nat Commun. 2015;6:6931. doi: 10.1038/ncomms7931. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
37. Bingel M, Lonnemann G, Koch KM, Dinarello CA, Shaldon S. Enhancement of in-vitro human interleukin-1 production by sodium acetate. Lancet. 1987;1:14–16. doi: 10.1016/S0140-6736(87)90703-3. [PubMed] [CrossRef] [Google Scholar]
38. Martinon F, Petrilli V, Mayor A, Tardivel A, Tschopp J. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature. 2006;440:237–241. doi: 10.1038/nature04516. [PubMed] [CrossRef] [Google Scholar]
39. Schorn C, Frey B, Lauber K, Janko C, Strysio M, Keppeler H, Gaipl US, Voll RE, Springer E, Munoz LE, Schett G, Herrmann M. Sodium overload and water influx activate the NALP3 inflammasome. J Biol Chem. 2011;286:35–41. doi: 10.1074/jbc.M110.139048. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
40. Anders HJ, Muruve DA. The inflammasomes in kidney disease. J Am Soc Nephrol. 2011;22:1007–1018. doi: 10.1681/ASN.2010080798. [PubMed] [CrossRef] [Google Scholar]
41. Darisipudi MN, Knauf F. An update on the role of the inflammasomes in the pathogenesis of kidney diseases. Pediatr Nephrol. 2015 [PubMed] [Google Scholar]
42. Jantsch J, Binger KJ, Muller DN, Titze J. Macrophages in homeostatic immune function. Front Physiol. 2014;5:146. doi: 10.3389/fphys.2014.00146. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
43. Titze J, Rakova N, Kopp C, Dahlmann A, Jantsch J, Luft FC. Balancing wobbles in the body sodium. Nephrol Dial Transplant. 2015 [PMC free article] [PubMed] [Google Scholar]
44. Ivanova LN, Archibasova VK, Shterental I. Sodium-depositing function of the skin in white rats. Fiziol Zh SSSR Im I M Sechenova. 1978;64:358–363. [PubMed] [Google Scholar]
45. Szabo G, Magyar Z. Electrolyte concentrations in subcutaneous tissue fluid and lymph. Lymphology. 1982;15:174–177. [PubMed] [Google Scholar]
46. Machnik A, Neuhofer W, Jantsch J, Dahlmann A, Tammela T, Machura K, Park JK, Beck FX, Muller DN, Derer W, Goss J, Ziomber A, Dietsch P, Wagner H, van Rooijen N, Kurtz A, Hilgers KF, Alitalo K, Eckardt KU, Luft FC, Kerjaschki D, Titze J. Macrophages regulate salt-dependent volume and blood pressure by a vascular endothelial growth factor-C-dependent buffering mechanism. Nat Med. 2009;15:545–552. doi: 10.1038/nm.1960. [PubMed] [CrossRef] [Google Scholar]
47. Wiig H, Schroder A, Neuhofer W, Jantsch J, Kopp C, Karlsen TV, Boschmann M, Goss J, Bry M, Rakova N, Dahlmann A, Brenner S, Tenstad O, Nurmi H, Mervaala E, Wagner H, Beck FX, Muller DN, Kerjaschki D, Luft FC, Harrison DG, Alitalo K, Titze J. Immune cells control skin lymphatic electrolyte homeostasis and blood pressure. J Clin Invest. 2013;123:2803–2815. doi: 10.1172/JCI60113. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
48. Muller S, Quast T, Schroder A, Hucke S, Klotz L, Jantsch J, Gerzer R, Hemmersbach R, Kolanus W. Salt-dependent chemotaxis of macrophages. PLoS One. 2013;8:e73439. doi: 10.1371/journal.pone.0073439. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
49. Machnik A, Dahlmann A, Kopp C, Goss J, Wagner H, van Rooijen N, Eckardt KU, Muller DN, Park JK, Luft FC, Kerjaschki D, Titze J. Mononuclear phagocyte system depletion blocks interstitial tonicity-responsive enhancer binding protein/vascular endothelial growth factor C expression and induces salt-sensitive hypertension in rats. Hypertension. 2010;55:755–761. doi: 10.1161/HYPERTENSIONAHA.109.143339. [PubMed] [CrossRef] [Google Scholar]
50. Lee KM, Danuser R, Stein JV, Graham D, Nibbs RJ, Graham GJ. The chemokine receptors ACKR2 and CCR2 reciprocally regulate lymphatic vessel density. EMBO J. 2014;33:2564–2580. doi: 10.15252/embj.201488887. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
51. Kopp C, Linz P, Wachsmuth L, Dahlmann A, Horbach T, Schofl C, Renz W, Santoro D, Niendorf T, Muller DN, Neininger M, Cavallaro A, Eckardt KU, Schmieder RE, Luft FC, Uder M, Titze J. (23)Na magnetic resonance imaging of tissue sodium. Hypertension. 2012;59:167–172. doi: 10.1161/HYPERTENSIONAHA.111.183517. [PubMed] [CrossRef] [Google Scholar]
52. Kopp C, Linz P, Dahlmann A, Hammon M, Jantsch J, Muller DN, Schmieder RE, Cavallaro A, Eckardt KU, Uder M, Luft FC, Titze J. 23Na magnetic resonance imaging-determined tissue sodium in healthy subjects and hypertensive patients. Hypertension. 2013;61:635–640. doi: 10.1161/HYPERTENSIONAHA.111.00566. [PubMed] [CrossRef] [Google Scholar]
53. Hammon M, Grossmann S, Linz P, Kopp C, Dahlmann A, Garlichs C, Janka R, Cavallaro A, Luft FC, Uder M, Titze J. 23Na Magnetic resonance imaging of the lower leg of acute heart failure patients during diuretic treatment. PLoS One. 2015;10:e0141336. doi: 10.1371/journal.pone.0141336. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
54. Dahlmann A, Dorfelt K, Eicher F, Linz P, Kopp C, Mossinger I, Horn S, Buschges-Seraphin B, Wabel P, Hammon M, Cavallaro A, Eckardt KU, Kotanko P, Levin NW, Johannes B, Uder M, Luft FC, Muller DN, Titze JM. Magnetic resonance-determined sodium removal from tissue stores in hemodialysis patients. Kidney Int. 2015;87:434–441. doi: 10.1038/ki.2014.269. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
55. Linz P, Santoro D, Renz W, Rieger J, Ruehle A, Ruff J, Deimling M, Rakova N, Muller DN, Luft FC, Titze J, Niendorf T. Skin sodium measured with 23Na MRI at 7.0 T. NMR Biomed. 2015;28:54–62. [PubMed] [Google Scholar]
56. Karaman S, Buschle D, Luciani P, Leroux JC, Detmar M, Proulx ST. Decline of lymphatic vessel density and function in murine skin during aging. Angiogenesis. 2015;18:489–498. doi: 10.1007/s10456-015-9479-0. [PubMed] [CrossRef] [Google Scholar]
57. Jantsch J, Schatz V, Friedrich D, Schroder A, Kopp C, Siegert I, Maronna A, Wendelborn D, Linz P, Binger KJ, Gebhardt M, Heinig M, Neubert P, Fischer F, Teufel S, David JP, Neufert C, Cavallaro A, Rakova N, Kuper C, Beck FX, Neuhofer W, Muller DN, Schuler G, Uder M, Bogdan C, Luft FC, Titze J. Cutaneous Na storage strengthens the antimicrobial barrier function of the skin and boosts macrophage-driven host defense. Cell Metab. 2015;21:493–501. doi: 10.1016/j.cmet.2015.02.003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
58. Schwartz L, Guais A, Pooya M, Abolhassani M. Is inflammation a consequence of extracellular hyperosmolarity? J Inflamm (Lond) 2009;6:21. doi: 10.1186/1476-9255-6-21. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
59. Inglese M, Madelin G, Oesingmann N, Babb JS, Wu W, Stoeckel B, Herbert J, Johnson G. Brain tissue sodium concentration in multiple sclerosis: a sodium imaging study at 3 tesla. Brain. 2010;133:847–857. doi: 10.1093/brain/awp334. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
60. Paling D, Solanky BS, Riemer F, Tozer DJ, Wheeler-Kingshott CAM, Kapoor R, Golay X, Miller DH. Sodium accumulation is associated with disability and a progressive course in multiple sclerosis. Brain. 2013;136:2305–2317. doi: 10.1093/brain/awt149. [PubMed] [CrossRef] [Google Scholar]
61. Galindo-Villegas J, Montalban-Arques A, Liarte S, de Oliveira S, Pardo-Pastor C, Rubio-Moscardo F, Meseguer J, Valverde MA, Mulero V. TRPV4-mediated detection of hyposmotic stress by skin keratinocytes activates developmental immunity. J Immunol. 2016;196:738–749. doi: 10.4049/jimmunol.1501729. [PubMed] [CrossRef] [Google Scholar]
62. Gault WJ, Enyedi B, Niethammer P. Osmotic surveillance mediates rapid wound closure through nucleotide release. J Cell Biol. 2014;207:767–782. doi: 10.1083/jcb.201408049. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
63. Enyedi B, Kala S, Nikolich-Zugich T, Niethammer P. Tissue damage detection by osmotic surveillance. Nat Cell Biol. 2013;15:1123–1130. doi: 10.1038/ncb2818. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
64. Scheie PO. Plasmolysis of Escherichia coli B-r with sucrose. J Bacteriol. 1969;98:335–340. [PMC free article] [PubMed] [Google Scholar]
65. Han J, Lee JD, Bibbs L, Ulevitch RJ. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science. 1994;265:808–811. doi: 10.1126/science.7914033. [PubMed] [CrossRef] [Google Scholar]
66. Buxade M, Lunazzi G, Minguillon J, Iborra S, Berga-Bolanos R, Del Val M, Aramburu J, Lopez-Rodriguez C. Gene expression induced by Toll-like receptors in macrophages requires the transcription factor NFAT5. J Exp Med. 2012;209:379–393. doi: 10.1084/jem.20111569. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
67. Kim NH, Choi S, Han EJ, Hong BK, Choi SY, Kwon HM, Hwang SY, Cho CS, Kim WU. The xanthine oxidase-NFAT5 pathway regulates macrophage activation and TLR-induced inflammatory arthritis. Eur J Immunol. 2014;44:2721–2736. doi: 10.1002/eji.201343669. [PubMed] [CrossRef] [Google Scholar]
68. Shapiro L, Dinarello CA. Osmotic regulation of cytokine synthesis in vitro. Proc Natl Acad Sci USA. 1995;92:12230–12234. doi: 10.1073/pnas.92.26.12230. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
69. Shapiro L, Dinarello CA. Hyperosmotic stress as a stimulant for proinflammatory cytokine production. Exp Cell Res. 1997;231:354–362. doi: 10.1006/excr.1997.3476. [PubMed] [CrossRef] [Google Scholar]
70. Junger WG, Liu FC, Loomis WH, Hoyt DB. Hypertonic saline enhances cellular immune function. Circ Shock. 1994;42:190–196. [PubMed] [Google Scholar]
71. Chou YC, Sheu JR, Chung CL, Hsiao CJ, Hsueh PJ, Hsiao G. Hypertonicity-enhanced TNF-alpha release from activated human monocytic THP-1 cells requires ERK activation. Biochim Biophys Acta. 2011;1810:475–484. doi: 10.1016/j.bbagen.2011.01.004. [PubMed] [CrossRef] [Google Scholar]
72. Roth I, Leroy V, Kwon HM, Martin PY, Feraille E, Hasler U. Osmoprotective transcription factor NFAT5/TonEBP modulates nuclear factor-kappaB activity. Mol Biol Cell. 2010;21:3459–3474. doi: 10.1091/mbc.E10-02-0133. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
73. Zhang WC, Zheng XJ, Du LJ, Sun JY, Shen ZX, Shi C, Sun S, Zhang Z, Chen XQ, Qin M, Liu X, Tao J, Jia L, Fan HY, Zhou B, Yu Y, Ying H, Hui L, Yi X, Zhang L, Duan SZ. High salt primes a specific activation state of macrophages, M(Na) Cell Res. 2015;25:893–910. doi: 10.1038/cr.2015.87. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
74. Hucke S, Eschborn M, Liebmann M, Herold M, Freise N, Engbers A, Ehling P, Meuth SG, Roth J, Kuhlmann T, Wiendl H, Klotz L. Sodium chloride promotes pro-inflammatory macrophage polarization thereby aggravating CNS autoimmunity. J Autoimmun. 2016;67:90–101. doi: 10.1016/j.jaut.2015.11.001. [PubMed] [CrossRef] [Google Scholar]
75. Zhang D, Wang C, Cao S, Ye Z, Deng B, Kijlstra A, Yang P. High-salt enhances the inflammatory response by retina pigment epithelium cells following lipopolysaccharide stimulation. Mediators Inflamm. 2015;2015:197521. [PMC free article] [PubMed] [Google Scholar]
76. Binger KJ, Gebhardt M, Heinig M, Rintisch C, Schroeder A, Neuhofer W, Hilgers K, Manzel A, Schwartz C, Kleinewietfeld M, Voelkl J, Schatz V, Linker RA, Lang F, Voehringer D, Wright MD, Hubner N, Dechend R, Jantsch J, Titze J, Muller DN. High salt reduces the activation of IL-4- and IL-13-stimulated macrophages. J Clin Invest. 2015;125:4223–4238. doi: 10.1172/JCI80919. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
77. Brownlie RJ, Zamoyska R. T cell receptor signalling networks: branched, diversified and bounded. Nat Rev Immunol. 2013;13:257–269. doi: 10.1038/nri3403. [PubMed] [CrossRef] [Google Scholar]
78. Coimbra R, Junger WG, Liu FC, Loomis WH, Hoyt DB. Hypertonic/hyperoncotic fluids reverse prostaglandin E2 (PGE2)-induced T-cell suppression. Shock. 1995;4:45–49. doi: 10.1097/00024382-199507000-00007. [PubMed] [CrossRef] [Google Scholar]
79. Junger WG, Hoyt DB, Hamreus M, Liu FC, Herdon-Remelius C, Junger W, Altman A. Hypertonic saline activates protein tyrosine kinases and mitogen-activated protein kinase p38 in T-cells. J Trauma. 1997;42:437–443. doi: 10.1097/00005373-199703000-00011. [PubMed] [CrossRef] [Google Scholar]
80. Loomis WH, Namiki S, Ostrom RS, Insel PA, Junger WG. Hypertonic stress increases T cell interleukin-2 expression through a mechanism that involves ATP release, P2 receptor, and p38 MAPK activation. J Biol Chem. 2003;278:4590–4596. doi: 10.1074/jbc.M207868200. [PubMed] [CrossRef] [Google Scholar]
81. Loomis WH, Namiki S, Hoyt DB, Junger WG. Hypertonicity rescues T cells from suppression by trauma-induced anti-inflammatory mediators. Am J Physiol. 2001;281:C840–C848. [PubMed] [Google Scholar]
82. Go WY, Liu X, Roti MA, Liu F, Ho SN. NFAT5/TonEBP mutant mice define osmotic stress as a critical feature of the lymphoid microenvironment. Proc Natl Acad Sci USA. 2004;101:10673–10678. doi: 10.1073/pnas.0403139101. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
83. Boland BS, Widjaja CE, Banno A, Zhang B, Kim SH, Stoven S, Peterson MR, Jones MC, Su HI, Crowe SE, Bui JD, Ho SB, Okugawa Y, Goel A, Marietta EV, Khosroheidari M, Jepsen K, Aramburu J, Lopez-Rodriguez C, Sandborn WJ, Murray JA, Harismendy O, Chang JT. Immunodeficiency and autoimmune enterocolopathy linked to NFAT5 haploinsufficiency. J Immunol. 2015;194:2551–2560. doi: 10.4049/jimmunol.1401463. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
84. Wu C, Yosef N, Thalhamer T, Zhu C, Xiao S, Kishi Y, Regev A, Kuchroo VK. Induction of pathogenic TH17 cells by inducible salt-sensing kinase SGK1. Nature. 2013;496:513–517. doi: 10.1038/nature11984. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
85. Kleinewietfeld M, Manzel A, Titze J, Kvakan H, Yosef N, Linker RA, Muller DN, Hafler DA. Sodium chloride drives autoimmune disease by the induction of pathogenic TH17 cells. Nature. 2013;496:518–522. doi: 10.1038/nature11868. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
86. Safa K, Ohori S, Borges TJ, Uehara M, Batal I, Shimizu T, Magee CN, Belizaire R, Abdi R, Wu C, Chandraker A, Riella LV. Salt accelerates allograft rejection through serum- and glucocorticoid-regulated kinase-1-dependent inhibition of regulatory T cells. J Am Soc Nephrol. 2015;26:2341–2347. doi: 10.1681/ASN.2014090914. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
87. Hernandez AL, Kitz A, Wu C, Lowther DE, Rodriguez DM, Vudattu N, Deng S, Herold KC, Kuchroo VK, Kleinewietfeld M, Hafler DA. Sodium chloride inhibits the suppressive function of FOXP3+ regulatory T cells. J Clin Invest. 2015;125:4212–4222. doi: 10.1172/JCI81151. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
88. Mehrotra P, Patel JB, Ivancic CM, Collett JA, Basile DP. Th-17 cell activation in response to high salt following acute kidney injury is associated with progressive fibrosis and attenuated by AT-1R antagonism. Kidney Int. 2015;88:776–784. doi: 10.1038/ki.2015.200. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
89. Dang VD, Hilgenberg E, Ries S, Shen P, Fillatreau S. From the regulatory functions of B cells to the identification of cytokine-producing plasma cell subsets. Curr Opin Immunol. 2014;28:77–83. doi: 10.1016/j.coi.2014.02.009. [PubMed] [CrossRef] [Google Scholar]
90. Yoshida T, Mei H, Dorner T, Hiepe F, Radbruch A, Fillatreau S, Hoyer BF. Memory B and memory plasma cells. Immunol Rev. 2010;237:117–139. doi: 10.1111/j.1600-065X.2010.00938.x. [PubMed] [CrossRef] [Google Scholar]
91. Kino T, Takatori H, Manoli I, Wang Y, Tiulpakov A, Blackman MR, Su YA, Chrousos GP, DeCherney AH, Segars JH. Brx mediates the response of lymphocytes to osmotic stress through the activation of NFAT5. Sci Signal. 2009;2:ra5. [PMC free article] [PubMed] [Google Scholar]
92. Nauseef WM, Borregaard N. Neutrophils at work. Nat Immunol. 2014;15:602–611. doi: 10.1038/ni.2921. [PubMed] [CrossRef] [Google Scholar]
93. Matsumoto T, Kumazawa J, van der Auwera P. Suppression of leukocyte function and intracellular content of ATP in hyperosmotic condition comparable to the renal medulla. J Urol. 1989;142:399–402. [PubMed] [Google Scholar]
94. Matsumoto T, van der Auwera P, Watanabe Y, Tanaka M, Ogata N, Naito S, Kumazawa J. Neutrophil function in hyperosmotic NaCl is preserved by phosphoenol pyruvate. Urol Res. 1991;19:223–227. doi: 10.1007/BF00305299. [PubMed] [CrossRef] [Google Scholar]
95. Matsumoto T, Takahashi K, Kubo S, Haraoka M, Mizunoe Y, Tanaka M, Ogata N, Naito S, Kumazawa J, Watanabe Y. Suppression of chemotactic activity of neutrophils in hyperosmotic conditions comparable to the renal medulla: partial preservation by phosphoenolpyruvate. Urol Int. 1993;50:1–5. doi: 10.1159/000282438. [PubMed] [CrossRef] [Google Scholar]
96. Takahashi K, Matsumoto T, Kubo S, Haraoka M, Tanaka M, Kumazawa J. Influence of hyperosmotic environment comparable to the renal medulla upon membrane NADPH oxidase of human polymorphonuclear leukocytes. J Urol. 1994;152:1622–1625. [PubMed] [Google Scholar]
97. Shafer WM, Onunka VC. Mechanism of staphylococcal resistance to non-oxidative antimicrobial action of neutrophils: importance of pH and ionic strength in determining the bactericidal action of cathepsin G. J Gen Microbiol. 1989;135:825–830. [PubMed] [Google Scholar]
98. Winkler RH (1978) The effect of halides (NaCl and NaI) on in vitro pancreatic elastase activity. Connect Tissue Res 6:89–92 [PubMed]
99. Chen Y, Hashiguchi N, Yip L, Junger WG. Hypertonic saline enhances neutrophil elastase release through activation of P2 and A3 receptors. Am J Physiol. 2006;290:C1051–C1059. doi: 10.1152/ajpcell.00216.2005. [PubMed] [CrossRef] [Google Scholar]
100. Junger WG, Hoyt DB, Davis RE, Herdon-Remelius C, Namiki S, Junger H, Loomis W, Altman A. Hypertonicity regulates the function of human neutrophils by modulating chemoattractant receptor signaling and activating mitogen-activated protein kinase p38. J Clin Invest. 1998;101:2768–2779. doi: 10.1172/JCI1354. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
101. Nielsen BW, Bjerke T, Damsgaard TM, Herlin T, Thestrup-Pedersen K, Schiotz PO. Hyperosmolarity selectively enhances IgE-receptor-mediated histamine release from human basophils. Agents Actions. 1992;35:170–178. doi: 10.1007/BF01997496. [PubMed] [CrossRef] [Google Scholar]
102. Soldati T, Neyrolles O. Mycobacteria and the intraphagosomal environment: take it with a pinch of salt(s)! Traffic. 2012;13:1042–1052. doi: 10.1111/j.1600-0854.2012.01358.x. [PubMed] [CrossRef] [Google Scholar]
103. Wang G, Nauseef WM. Salt, chloride, bleach, and innate host defense. J Leukoc Biol. 2015;98:163–172. doi: 10.1189/jlb.4RU0315-109R. [PMC free article] [PubMed] [CrossRef] [Google Scholar]
104. Soares MP, Gozzelino R, Weis S. Tissue damage control in disease tolerance. Trends Immunol. 2014;35:483–494. doi: 10.1016/j.it.2014.08.001. [PubMed] [CrossRef] [Google Scholar]
105. Gaddy JA, Radin JN, Loh JT, Zhang F, Washington MK, Peek RM, Jr, Algood HM, Cover TL. High dietary salt intake exacerbates Helicobacter pylori-induced gastric carcinogenesis. Infect Immun. 2013;81:2258–2267. doi: 10.1128/IAI.01271-12. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

 

[not_James_Bond]

These are my thoughts:

Also, purified salt (which they used for all these studies above) acts very differently than unrefined salt:
Natural sea salt consumption confers protection against hypertension and kidney damage in Dahl salt-sensitive rats

In general, that one rat study above is the best evidence we have thus far that refined salt acts completely differently from unrefined salt.

@GAF Did you read this article
Our findings show that consumption of natural sea salt induces less hypertension compared to refined salt in the Dahl salt-sensitive rat.

 

[Tristan Loscha]

@GAF Did you read this article
Our findings show that consumption of natural sea salt induces less hypertension compared to refined salt in the Dahl salt-sensitive rat.

From the article you mentioned, RS are groups in refined salt, SS are groups in sea salt, difference is ok, but not big imo:

 

[GAF]

Seems reasonable for an ordinary citizen to use sea salt from sources that bypass the global monopoly system. Trust Nature and Human/animal history before trusting the DDCCF (Depopulation Death Cult Control Freakazoids).

Has anyone independently tested the iodine content of Mortons salt, or maybe even the salt itself?

I am suspicious.

 

[SlowWalker]

So can anyone dispute all the research that Tristan is posting about the harmful effects of NaCl?
If Ray is suggesting higher levels of salt intake, how can it be that so much of what has been posted in this thread seems to go against those recommendations?
Also is the difference between pure NaCl and sea/Himalayan salt really enough to nullify all the effects from the posted studies?

I am on the pro salt side but my partner has been trying to convince me salt is as bad as PUFAs (she eats zero salt) so I came here expecting to find some info to refute her but this thread has me less sure (not that it’s bad as PUFA).

 

[SlowWalker]

Also what do people think about this

The salt conspiracy

From page 18… Sodium Vs. Sodium Chloride “To clearly understand these “truths” revealed in this salt expose, it is now necessary to make a crucial distinction: between sodium and sodium chloride.…

wemustknow.wordpress.com

“Sodium chloride is an ionic compound that is synthesized when oppositely charged atoms or ions of sodium and chloride join together through an electrostatic ionic bond. More ionic bonds are formed as additional sodium ions and chloride ions attach to sodium chloride, building up a salt crystal lattice. When this sodium chloride crystal dissolves in water, the ionic bonds in the lattice are broken apart by water molecules, releasing the positively-charged sodium ions and negatively-charged chloride ions. These released ions retain their opposite charges and continue to attract each other as constituents of sodium chloride’s chemical structure, but in an aqueous state. Similarly, water may change to an aqueous state (liquid), crystallized state (ice) or vaporized state (steam), but it still retains its chemical structure as water.”

“The body needs a continuous supply of sodium ions and chloride ions to perform various biological functions, so aqueous sodium chloride which contains both types of ions seems suitable to fill that demand. But there is a problem. The biochemical functions and locations in the body that require positive sodium ions are separate from those functions and locations requiring negative chloride ions. For example, one of the most important uses of free sodium ions in the body occurs in the nervous system. The exchange across cell membranes of positive sodium ions with negative potassium ions generates action potentials which send electric current throughout the nervous system. Without sufficient quantities of free sodium ions and other ionic electrolytes obtained in the diet, this biochemical reaction cannot occur, and the body cannot function.”

“Unfortunately, wherever sodium ions go in aqueous sodium chloride, the chloride ions are attracted to follow right along. If you have a cup of salt water, you can’t pour out only the portion of the water with sodium ions or only the portion with chloride ions. The charged ions never clump together in fluid, but maintain their electrical equilibrium by distributing themselves evenly throughout the aqueous solution. Thus, positive and negative ions in an aqueous state of sodium chloride remain interconnected in the same chemical proportions as they do in the crystallized state. The sodium chloride in salt water also retains the same taste as the sodium chloride in salt crystals. Only industrial methods like electrolysis can neutralize and remove the chloride ions from aqueous sodium chloride, which produces chlorine gas when an electrical current is run through salt water (brine).”

“All sodium chloride ingested by the body is either already in an aqueous state or is quickly converted to an aqueous state in the body’s fluids. But how will the body manage to avoid having the oppositely charged chloride ions follow along wherever sodium ions are needed in the body, like in the nervous system? How can the body neutralize and remove the chloride ions from the ingested aqueous sodium chloride without having access to an industrial strength electrical current, as in electrolysis which also releases poisonous chlorine gas? It can’t! And that explains why ingested sodium chloride is useless to the body as a nutrient.”

“Unlike natural food, sodium chloride cannot provide any free sodium ions to the body, no matter how much it dissolves in water because sodium ions remain electrostatically attached to chloride ions in an aqueous state. Sodium chloride is consumed, circulated, and excreted as sodium chloride, without ever changing its chemical structure, regardless how much it changes between an aqueous and crystallized state. This type of inert chemical reaction never occurs in a nutrient that is metabolized by the body; it commonly occurs when a poisonous drug is consumed and eliminated.”

“In pharmacology, a drug’s response in the body, more accurately described as the body’s response to an inert poison, is called the drug’s pharmacodynamics, and the body’s absorption and elimination of this poison is known as the drug’s pharmacokinetics. Pharmacology texts clearly list the pharmacokinetic and pharmacodynamic properties of sodium chloride, confirming its use as a drug and a poison. As with all other drugs, adverse effects of sodium chloride use are listed in medical books. Sodium chloride’s retention and excretion by the body places a large strain on kidneys and other organs, damaging tissue and raising blood pressure as the body retains water in extracellular tissue to dilute salt.”

 

[Peatness]

So can anyone dispute all the research that Tristan is posting about the harmful effects of NaCl?
If Ray is suggesting higher levels of salt intake, how can it be that so much of what has been posted in this thread seems to go against those recommendations?
Also is the difference between pure NaCl and sea/Himalayan salt really enough to nullify all the effects from the posted studies?

I am on the pro salt side but my partner has been trying to convince me salt is as bad as PUFAs (she eats zero salt) so I came here expecting to find some info to refute her but this thread has me less sure (not that it’s bad as PUFA).

Did you find answers to this?

 

[Apple]

Time to rethink salt | Jens Titze | TEDxNashvilleSalon









A german Professor of Electrolyte and circulatory research,trained as nephrologist,
and the conductor of the Sodium research that was part of MARS 500 aerospace research.


He is a critic of NaCl,and believes in the disorders that come from osmotically neutral sodium retention.

Bump .
So, how much salt ? 6, 9, or 12 g/day ...

Sodium Handling and Interaction in Numerous Organs - PubMed

Salt (NaCl) is a prerequisite for life. Excessive intake of salt, however, is said to increase disease risk, including hypertension, arteriosclerosis, heart failure, renal disease, stroke, and cancer. Therefore, considerable research has been expended on the mechanism of sodium handling based on...

pubmed.ncbi.nlm.nih.gov

It looks like Jens Titze knows what he is talking about

Player: Jens M. Titze, MD - Why We Eat What We Eat, and Why What You Thought You Knew about Salt and Water Balance was all Wrong - ENDO 2018

 

[Apple]

Bump .
So, how much salt ? 6, 9, or 12 g/day ...

Sodium Handling and Interaction in Numerous Organs - PubMed

Salt (NaCl) is a prerequisite for life. Excessive intake of salt, however, is said to increase disease risk, including hypertension, arteriosclerosis, heart failure, renal disease, stroke, and cancer. Therefore, considerable research has been expended on the mechanism of sodium handling based on...

pubmed.ncbi.nlm.nih.gov

It looks like Jens Titze knows what he is talking about

Player: Jens M. Titze, MD - Why We Eat What We Eat, and Why What You Thought You Knew about Salt and Water Balance was all Wrong - ENDO 2018

He says that sodium accumulates in the body (in muscles and blood vessels) longterm and that is not good. Old people show lot's of sodium in their vessels.

If we are talking about salt to taste it will be a quater of teaspoon for me

 

[Peatress]

He says that sodium accumulates in the body (in muscles and blood vessels) longterm and that is not good. Old people show lot's of sodium in their vessels.

If we are talking about salt to taste it will be a quater of teaspoon for me

I've tried to find information about tissue bound sodium but sadly there is very little info. I asked a doctor who told me that serum sodium is a good indicator of the overall body sodium content. But it seems Dr.Titze is arguing otherwise. He seems to be saying that some people can have normal serum sodium but excess storage in tissues. Without the sophisticated imaging he is proposing how would someone know if they have excess tissue sodium?

1/4 teaspoon of salt per day sounds pretty low

 

[Apple]

I've tried to find information about tissue bound sodium but sadly there is very little info. I asked a doctor who told me that serum sodium is a good indicator of the overall body sodium content. But it seems Dr.Titze is arguing otherwise. He seems to be saying that some people can have normal serum sodium but excess storage in tissues. Without the sophisticated imaging he is proposing how would someone know if they have excess tissue sodium?

1/4 teaspoon of salt per day sounds pretty low

My taste buds are comfortable on average with 1/4 teaspoon of salt per day ... that would be a pinch of salt with every meal. But sure there is some sodium in most foods anyway, cheese always has sodium, fruits probably too.
I don't remember seeing anyone salting their food for the last 10 years . :))

In his animal studies Dr.Titze says that on high salt diet mice required 20- 30 percent more food so as to grow to normal size as low salt group. Salt induced catabolic state and mice needed more food to compensate. I they eat equally as low sodium mice they were loosing lots of weight (mostly muscles) . (00:23min)
Looks like wasted metabolism ?

 

[Peatress]

My taste buds are comfortable on average with 1/4 teaspoon of salt per day ... that would be a pinch of salt with every meal. But sure there is some sodium in most foods anyway, cheese always has sodium, fruits probably too.
I don't remember seeing anyone salting their food for the last 10 years . :))

In his animal studies Dr.Titze says that on high salt diet mice required 20- 30 percent more food so as to grow to normal size as low salt group. Salt induced catabolic state and mice needed more food to compensate. I they eat equally as low sodium mice they were loosing lots of weight (mostly muscles) . (00:23min)
Looks like wasted metabolism ?

Thank you. It's interesting to hear about the weight loss in the high sodium mice. Do you know the human equivalent salt intake which would induce weight loss? Of course this kind of weight loss would not be desirable because it’s muscle loss. I’ve listen to Dr.Titze’s lectures previously and I'm still not satisfied with his findings. He is saying people accumulate tissue sodium with age then he presents case of an 80 year old with hypertension. Someone with kidney or heart issues is not going ot handle salt in a normal manner. What about an 80 without hypertension do they retain the same amount of tissue sodium. Also what happens when their salt intake is restricted/or lowered? Does the hypertension resolve?

 

[Peater]

Just bumping this as I have been looking at my salt intake with regards to body composition, cortisol/stress and aldosterone. Perhaps retaining too much water. I had a big surprise when I found something I quoted recently where Ray himself actually ate "Low salt" while doing his forestry work. My understanding is, as long potassium, calcium and magnesium are sufficient it is OK. It's not about guzzling salt, although I do find it warming and somewhat relaxing, it's more nuanced than I realised.