Genes And PUFA

[Luann]

SNP's?

 

[Blossom]

SNP's?

Single nucleotide polymorphisms

 

[humpty-dumpty]

I think you folks are to smart for me . I wonder what your education and IQ levels are. WOW. I do get some of what you are talking about.
I love reading it all, even though I have to google a lot of the words. I really admire you.

 

[BigYellowLemon]

I am double CC for both SNP's. I don't necessarily think this is a bad thing. I view this as my body having more accurate mechanisms for controlling PUFA. In the context of a high PUFA diet, it could be bad. Also I bet the PUFA's my body creates are of higher quality than the ones consumed via food (rancidity vs freshly made by my body).

I am almost completely Scandinavian, English, and broadly Eastern European, according to 23andMe. I am also in the 99th percentile of Neanderthal genes, meaning I am Neanderthal than 99% of 23andMe customer, about 4% apparently. Even with this heavy European ancestry, I still have genes that result in high PUFA synthesis. Don't assume, get things tested.

I tend to do worse with high fat I think. My week of rice skim milk sweet potatos and OJ felt pretty good to me.

 

[Luann]

So, it seems like: SNP's are some kind of minion, or whatever, a mechanism, pathway, anyway they make desaturase possible.

Right?

They're like gears in the desaturase 5, 6, 9 watch face. They make it happen.

The thing is, why are you worried about desaturases. They need a substrate that already has a double bond. (Except the one that synthesizes oleic from saturated. And Mead's.) So if you aren't eating any PUFA, you have no PUFA to desaturase into more unsaturated fat. You're starving the desaturases of their substrate.

 

[Regina]

I am double CC for both SNP's. I don't necessarily think this is a bad thing. I view this as my body having more accurate mechanisms for controlling PUFA. In the context of a high PUFA diet, it could be bad. Also I bet the PUFA's my body creates are of higher quality than the ones consumed via food (rancidity vs freshly made by my body).

I am almost completely Scandinavian, English, and broadly Eastern European, according to 23andMe. I am also in the 99th percentile of Neanderthal genes, meaning I am Neanderthal than 99% of 23andMe customer, about 4% apparently. Even with this heavy European ancestry, I still have genes that result in high PUFA synthesis. Don't assume, get things tested.

I tend to do worse with high fat I think. My week of rice skim milk sweet potatos and OJ felt pretty good to me.

I'd have to dig around to find my prometheus read of my 23andMe. I had 7% neanderthal. 100% irish. APOE4. Even a warrior gene. Basically called me a knuckle dragger.

 

[BigYellowLemon]

I'd have to dig around to find my prometheus read of my 23andMe. I had 7% neanderthal. 100% irish. APOE4. Even a warrior gene. Basically called me a knuckle dragger.

Hahah that's awesome!

Is the warrior gene you're talking about MAO-A?

Do you know what APOE4 does?

 

[Drareg]

I have my raw data and tried to interpret them in Livewello but never understood how to do it and never really took the time to explore it.

It just tells you what way you are leaning so to speak,you can change them but it's good to help with the guess work.
Do you have a facility to search through your genes and find the mentioned fads1 and fads2?

 

[Drareg]

So, it seems like: SNP's are some kind of minion, or whatever, a mechanism, pathway, anyway they make desaturase possible.

Right?

They're like gears in the desaturase 5, 6, 9 watch face. They make it happen.

The thing is, why are you worried about desaturases. They need a substrate that already has a double bond. (Except the one that synthesizes oleic from saturated. And Mead's.) So if you aren't eating any PUFA, you have no PUFA to desaturase into more unsaturated fat. You're starving the desaturases of their substrate.

It's out of curiosity to see where your heritage is originating from to try guess why they developed this adaption in those regions.
It might not be a bad idea for someone with said genes switched on to almost cut fat completely rather than consuming coconut oil and the like.

 

[Luann]

It might not be a bad idea for someone with said genes switched on to almost cut fat completely rather than consuming coconut oil and the like.

Totes magotes. Although again the WORST any human desaturase can do to coconut oil, besides further desaturating its 4% or whatever PUFA, is turn it to MUFA. If you're worried about MUFA membranes then yes what you said is right.

 

[lvysaur]

Even with this heavy European ancestry, I still have genes that result in high PUFA synthesis. Don't assume, get things tested.

Of course, ancestry is not very meaningful for the individual when you're talking about population differences like 20% vs. 80%. If airplanes crashed 20% of the time, nobody would fly.

So, it seems like: SNP's are some kind of minion, or whatever, a mechanism, pathway, anyway they make desaturase possible.

DNA is biological code. Ray has valid points about the malleability of that code, but there is nonetheless a permanence of it within one's lifetime.

A portion of a gene might look like this: ...ACCAGTCA......
There are several genes on each chromosome.

Let's pretend that the second C correlates with the cholesterol PUFA relationship. That is to say, people with C in that position develop high blood cholesterol when eating PUFA.

Everyone has two copies of each non-sex chromosome (mom and dad), and thus of pretty much every gene. So there will be another portion on the second chromosome, on the same gene, which will contain either another C, or a T, at the identical position.

So for this trait, people with the C/C genotype (C in that specific position for both chromosomes) will develop high cholesterol while eating PUFA. People with the T/T genotype will not. People with the C/T genotype will probably be intermediate.

These SNPs are not the only way that genes code for traits. A good example is salivary amylase, which is not determined by a single nucleotide change. Instead, it is defined by the repetition of a specific pattern. Let's pretend that a portion of DNA says "ATGG". What we find is that people who have that pattern 5 times (ATGGATGGATGGATGGATGG) have more amylase than people with only 2 repeats (ATGGATGG). These types of coding are called "microsatellites". The MAO "aggression" gene, as mentioned by a few others in this thread, is similarly defined by microsatellites.

An allele is any sort of variant, SNP or microsat or otherwise, within a gene.

Now, as for the issue of how this code actually gets translated into results, I don't know at this time.

It might not be a bad idea for someone with said genes switched on to almost cut fat completely rather than consuming coconut oil and the like.

It might not, or it might. This is simply one allele, and high cholesterol is not the death sentence that the west makes it out to be.

Another quip is that some people are a little too "race" obsessed--populations that look "the same" can still have very different allele frequencies for certain traits. Across European ethnic groups, lactase persistence rates vary from 20% to 90%. I've known Asian people who've stopped drinking milk because "they heard they were lactose intolerant or something", which is obviously a very unwise way to make one's choices. (In this particular case, the lactose intolerant might even benefit more from lactose due to growth of gram positive bacteria)

I ancestrally come from a rather arid, hot climate, and I've had the best health of my life eating copious amounts of coconut oil, sugar, and milk.

 

[Luann]

@Ivysaur thank you for that lesson, very helpful of you to explain that.

 

[BigYellowLemon]

Of course, ancestry is not very meaningful for the individual when you're talking about population differences like 20% vs. 80%. If airplanes crashed 20% of the time, nobody would fly.

Yes that was the point I was trying to make.

I actually think that an SNP like this will make no meaningful difference. This SNP is just a small slice of the many variables that go into how you individually handle PUFA's.

 

[Parsifal]

Has it been proven that environment and metabolism can change "bad" SNPs slowing things down and enzymes and "bad" mutations?

 

[johnwester130]

so eating soybean oil is bad for me ?